Transcript

parp3-201

ID
ZDB-TSCRIPT-090929-7466
Name
parp3-201
Previous Names
  • parp3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024647 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024647|OTTDARG00000019901|ZDB-GENE-030131-7435 parp3|OTTDARP00000020333 parp3-001 LG_ BX664752.20 Danio rerio protein_coding KNOWN, 2456 bp
AGTCTGCAGACAGTGTCGAACAGTGAGAGTGAATCTGCAA
ACTTTCCCTGTACCGCCAGTATCAGAGGACAAAGATGGCA
CCCAAGAGAAGGGCAGCATCGAGCACCAAAGCTGGAGGGA
AGAAAGTCAAGCAGGAGACGCAGCCTGAAGCTCCACCCAA
GGACAAATTCACTTCCGCCAAAGAGGCCCTGAAGGCAACA
GGATCGCAGGTGAAGGGCACAAGGAACCCAGACAGCGTAT
GTCATCTGTCAAATGCTGAGGTTCACGAGGATTACGACTG
TATGCTTAACCAAACCAACATAGGAAACAACAACAACAAA
TTCTATGTAATCCAGGTCTTAGTGTCTGGAGGGAAGTACT
ACTGCTGGACAAGATGGGGAAGAGTGGGAGAGTCGGGCCA
AAACGCTTTAGCTGGTCCATCTGCCGCTGATGCAGCCATT
AAGAGTTTTGAGAAGAAATTCAAAGAGAAGACCAAGAATA
ATTGGAGCGACCGAGAAAACTTTGTCTCACATTCTGGGAA
ATACACATTGATAGAAGTGGACGGGGACCAAGATGCAGAA
GTGAAGGTGGACTCTGTGGATGGTGGAGCTGTGAAGGTGA
AAAGAGAACAAAATGTTTTGCCTTGTACATTGGATGCTGA
AACTCAAAGACTCATGCGATTCATCTTCGACAATGACATG
TTCAAAGAAGCCATGACCAGCATGGACCTAGATATTAAGA
AGATGCCCTTGGGGAAACTCAGCAAGCAGCAGATAGCCAA
AGGCTTTGAGGCTTTGGAGGAAATTGAAGCTGCAATAAAG
AAAAGTGAACGGAGCAAGTTTGAAGAACTCACCAACAAAT
TCTTTACCATAATTCCTCATAACTTTGGCCGCAACAGACC
CCCTGTCATTTCTGATGATTCTGTTCTTCAGAGCAAGAAG
GAGATGCTTTTGGTTCTTGCAGATATTGAGGTTGCCCAGA
GTCTTAAAGCTGAATCTGAGAAAGCCAAGGAAGAGATGGA
GGACACTGTGCCTCATCCAGTTGACCAAAATTACCAGTCT
CTGAAATGCAGTCTGAATCTGGTGGATAAGAAGTCAAAGG
AATATAAGATCATTGAGAAGTACTTGAAGGCCACTGGACA
AGAAGGACTCACTCTCGTGGATGTATGGGAAGTTGACAGA
GAAACAGAGGCTGAACGCTTCAGGGAAAATGATGCATTGG
AGAACCGGAAGCTGCTTTGGCATGGAACAAATGTGGCAGT
GGTTGCAGCCATTCTGAAGAGTGGTCTTCGCATCATGCCT
CATTCTGGTGGACGTGTGGGCAGGGGAATCTATTTTGCCT
CTGAAAACAGTAAATCTGCTGGCTATGTGCGTCCATCAAA
CAAAATTGGCATCATGTTTCTAAATGAAGTTGCTTTGGGA
AAGGAGTACACCATCACACGGGACGATCCCAGCTTAAGAA
AGGCACCCGCTGGCTATGACAGTGTAATTGCACGTGGAAA
CCAAGAACCAGATCCTTCAAAAGATGTCTTCATTGAACTT
GATGGTAAAAAGGTGGTGGTTCCTCAGGGAAAAGCCATAA
AACAGCAGCAATACGAGGGAAGTCATTTCTACAACAGTGA
GTACCTCATCTATAAGGAAAGCCAGTGCCGCATCCGATAC
CTCTTGGAGTTGAAGTTTAATTATTACTAGAGATGCAAAT
CAAGAAACTGTATCTACATACAGCACAGCCACTTATAAAA
GCCACTTCTGATATGTGGTTTCGCTCGTATAAAGTGCTGA
ATGTTTGAGGTAATTACTGAGTTGGAAATTCATTGAAGTT
CTGTTTTTGAAAGCTACAGTACACAACAACGTTTTTATGT
ACTGTAAACCTTAGTGTGATCTTACAATATGTTTGCTCAT
TTTGTCATATCCCTGAGTGAAGTTTAAATGTCTTTTATCA
TTTATTTTCTGCAATATCTTATTCAAGTTCAAAACAGATT
TACTGGTTTCAGTAGTGTCAGAACAACAAGTTATTACATG
TGTTTAAACATCTTTAAGCATTTATAAAAACTTGAGTCAG
GGAGCATATATGTATATATACATATATCTATAGTAATTTA
GGGGGAAATGAAGACAGATAAAATATTGTAATTGTTTTTT
GTTTTTAAAGTTTAATTTTGCACTAATCAATACAGTAATG
TGCATGTGACTTGCTGACTCATTGCTGAAAAGCATAGCTT
GTGAAGGTAATGTGATGCTCTGGACCCTTATATATTTGCT
TGATGTTAAAGGAAAGGTCTTATACATGCACAAATGCAAC
ATACTGTATTGTTTGTTTATAGTTATCTTTTCTTATATAC
TTATACTTAAAGTTACTTATCTTCATAGTTATCTTTTTTT
TTTACATCTTATGGTGAGTTTTGAAGTTCCAACATAAATG
TTAATGTGAGGACTTGGCACTTAAACAATCTGAAGATAAT
AAATCATTATACTTAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations