ZFIN ID: ZDB-TSCRIPT-090929-7458
Transcript Name: arpc4-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024637 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024637|OTTDARG00000019895|ZDB-GENE-010724-9 arpc4|no_translation arpc4-002 LG_ CR450814.4 Danio rerio protein_coding KNOWN, 812 bp
GACGGCGACTCTGCGTCCGTACCTGAATGCGGTGCGTGCT
ACACTGCAGGCAGCTCTCTGTCTGGAGAACTTCTCCTCAC
AGGTGGTGGAAAGACACAACAAACCTGAGGTTGAAGTCCG
GCTGATGAGATCGAAAAGATCCTGTGTCACAAGTTTATGC
GCTTCATGATGATGAGAGCCGAGAACTTCTTCATCCTTAG
GAGAAAACCTGTGGAGGGATATGACATCAGTTTCCTCATT
ACCAACTTCCACACAGAACAAATGTACAAGCATAAGTTAG
TGGACTTTGTCATCCATTTCATGGAGGAGATCGACAAGGA
AATCAGTGAGATGAAACTGTCAGTCAACGCCAGGGCTCGC
ATAGTTGCAGAGGAGTTCCTCAAAAACTTTTAAGAAACGA
TCAGCACACCTTCTGCTGGCTGCAATACCCTATCACCGTA
AAACACCTACGGAGAGCTTTGGGGCCATTGGGGAAGGAGC
TAAGGTGTGTTTGATTCCTGGACCATCACCACAGCTGGAT
CCAGAAGGGTCACAGGAATGATTTCAGAGTATTGCATTAT
TGTAACTTGAGAGCAAAGTGACGGATTTAACAGACAGGCA
CGGTACTCCATTTGTTGTCTGTTCTACTCCTTTTTTTTTT
GCCCTGTTTTTTTAACTTTTGCTAATTGCCTAATTTTTTT
AAAGTATTTGTTTCTTCACATTCAGCAAATTTCTTTGCAT
TCCGTCTCTTTTCATCTTATCCCACATACCTTCGTTATTA
TGCAGTAGTAGCAGTAGTAAAGTGCTTACAACTTTGCAAT
ATTCTGAATATG

arpc4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arpc4-203 (1)    Ensembl 2148
ncRNA arpc4-002 812
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arpc4-002 Contained in:
[BAC] CH211-157B11 (1)

Genome Resources: Vega_Trans:OTTDART00000024637 (1),  Ensembl_Trans:ENSDART00000143889 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT692369 (1) 832 nt
CITATIONS (2)