ZFIN ID: ZDB-TSCRIPT-090929-7457
Transcript Name: arpc4-203
Previous Name: arpc4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024636 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024636|OTTDARG00000019895|ZDB-GENE-010724-9 arpc4|OTTDARP00000020326 arpc4-001 LG_ CR450814.4 Danio rerio protein_coding KNOWN, 2148 bp
AAGTTGGTATCTTCCTATGAGTGGCGTTACTTGCGGAAGT
CGCCCGGTGTTTGTAGCACTTCCGTCTTCTGCTCCAGCGG
GTACACAGAAATGGACGGCGACTCTGCGTCCGTACCTGAA
TGCGGTGCGTGCTACACTGCAGGCAGCTCTCTGTCTGGAG
AACTTCTCCTCACAGGTGGTGGAAAGACACAACAAACCTG
AGGTTGAAGTCCGGAGCAGTAAAGAGCTGTTGCTTCAGCC
TGTTGTGATCAGTAGGAATGATAAAGAAAAGGTCCTAATA
GAAGGTTCCATCAACTCTGTGCGGGTCAGCATTGCTGTCA
AACAGGCTGATGAGATCGAAAAGATCCTGTGTCACAAGTT
TATGCGCTTCATGATGATGAGAGCCGAGAACTTCTTCATC
CTTAGGAGAAAACCTGTGGAGGGATATGACATCAGTTTCC
TCATTACCAACTTCCACACAGAACAAATGTACAAGCATAA
GTTAGTGGACTTTGTCATCCATTTCATGGAGGAGATCGAC
AAGGAAATCAGTGAGATGAAACTGTCAGTCAACGCCAGGG
CTCGCATAGTTGCAGAGGAGTTCCTCAAAAACTTTTAAGA
AACGATCAGCACACCTTCTGCTGGCTGCAATACCCTATCA
CCGTAAAACACCTACGGAGAGCTTTGGGGCCATTGGGGAA
GGAGCTAAGGTGTGTTTGATTCCTGGACCATCACCACAGC
TGGATCCAGAAGGGTCACAGGAATGATTTCAGAGTATTGC
ATTATTGTAACTTGAGAGCAAAGTGACGGATTTAACAGAC
AGGCACGGTACTCCATTTGTTGTCTGTTCTACTCCTTTTT
TTTTTGCCCTGTTTTTTTAACTTTTGCTAATTGCCTAATT
TTTTTAAAGTATTTGTTTCTTCACATTCAGCAAATTTCTT
TGCATTCCGTCTCTTTTCATCTTATCCCACATACCTTCGT
TATTATGCAGTAGTAGCAGTAGTAAAGTGCTTACAACTTT
GCAATATTCTGAATATGCCTCAGCGTTCCCTTGTGCTCAT
GAATATTAATGAGCAGGTACTGTACATATTAAAAAGGATA
GACTCATTTTACTTCTGCCTTTTTAACTAACTTTAAATCA
GGGCGGGTCTATTGGATGAATGCGCATCTATGTTCACGAG
CACAAAGGAAATGGTGTTCCAATAATTTAACAGATTATTT
TGTCAGTGTTTTTTATAAATATGTATACTGTGTTCTGACG
ACCATTTTTTCATGTTGAGTTTTGATATAAAAATCCTCAC
GCTGGTGCACATGGATCTTACAAACCATATCATGATGATG
ATGCTAAATAAATCCCTTTATTGCTTATATTGTGTGGTGT
ACTGTGGGAATGAAAGCTTGTGGATCGGTTGATTTTTATG
GTAAGGTTACCTGCAGTTTGCCTACACTTTTTTTTTTTTG
TATTGATTTCTTCTGATGCTCAGACATTTTTTAAAGCAAG
TGGTCAGACCAATACAAACTTAAATGGTAGGCAAATATCA
CCCCAGCTAGCATTTTCTGTTTTAAAAGATGTCTAATAGA
CGTCTAAACATGGTCGTCTTGCCTAAAACAAGGCTAAATT
TGGGCTGTCGGTGAAAATCTAATAGGTGTCTAAGAATAAG
CCAAAACTAGACTAGTCATCAAATAAACAGAAATGAATGA
CTTCACATATAAAGTGTCTCTATTTGACGACTAGTCTAGT
TTTAGGCAAATTTATTCTTGTTTAAGCCAAGACGACCATT
TTTAGACATCTATTGGACAGATTTTCACTGACAGCCCAAG
TTAGCCTTTGTTTTAGTCAAGCTGTCTACGTTTAGATATC
TATTAGGCGTCTATTAAACAAAACTGTTTGCTGGGAACTT
TTTTCTTTCACATATGTAGAAACTGTAATGTTTTTCACCT
ATTTTAAAATGTAGAACAAAGTTTTCACAAATAATCTAGA
TCTATCATTTATTCCAGAGTTAAAGAGTCCAATCCTATTA
TACGGTTTACTTTTGACATTTTAAAATGGTTAGCGTTGCA
GTTAAGTATTCCCTATTACCAATATATGTTTTAGCATAAG
ATAAAGCAATGGAGCTTATGTTTATACAACCTTTACTTCT
TTTTACAATAAAATTAGATCAAAACGAA

arpc4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA arpc4-203 2148
ncRNA arpc4-002 (1)    Ensembl 812
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
arpc4-203 Contained in:
[BAC] CH211-157B11 (1)

Genome Resources: Vega_Trans:OTTDART00000024636 (1),  Ensembl_Trans:ENSDART00000146470 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC065899 (1) 1296 nt
GenBank:CV487611 (1) 884 nt
GenBank:CK352743 (1) 862 nt
GenBank:CV107349 (1) 788 nt
GenBank:CV485850 (1) 788 nt
GenBank:CK706724 (1) 774 nt
GenBank:CT675835 (1) 742 nt
GenBank:AW280130 (1) 438 nt
CITATIONS (2)