ZFIN ID: ZDB-TSCRIPT-090929-7447
Transcript Name: krt4-201
Previous Name: krt4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024624 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024624|OTTDARG00000019886|ZDB-GENE-000607-83 krt4|OTTDARP00000020316 krt4-001 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 2469 bp
GACTTTGACTCTCCTTTGTGAGCAACCTCCTCCACTCACT
CCTCTCTCAGAGAGCACTCTCGTACCTCCTTCTCAGCAAC
TCAAAGACACAGGCATCATGTCAACCAGGTCTATCACCTA
CTCCAGCGGTGGCTCCATCAGGAAGGGCTACACCAGCCAG
TCAGCCTATGCAGTACCTGCCGGCTCTACCAGGATGAGCT
CAGTGACCAGTGTCAGGAGATCTGGTGTGGGTGCCAGCCC
AGGCTTCGGTGCCGGTGGCAGCTACAGCTTCAGCAGCAGC
AGCATGGGTGGAGGCTATGGAAGTGGTCTTGGTGGAGGTC
TTGGTGGAGGCATGGGCTTCGTTGCGGCTCCTATCACAGC
TGTAACTGTCAACCAGAGCCTGTTGGCCCCCCTCAACCTG
GAAATTGACCCCACAATTCAGGCTGTCCGCACTCAGGAGA
AAGAGCAAATTAAGACCCTCAACAACCGCTTCGCTTCCTT
CATCGACAAAGTGCGCTTCCTGGAACAGCAGAACAAGATG
CTGGAGACCAAATGGAGTCTTCTCCAAGAACAGACAACCA
CACGTTCCAACATCGATGCCATGTTTGAGGCATACATCTC
TAACCTGCGCAGACAGCTCGATGGACTGGGAAATGAGAAG
ATGAAGCTGGAGGGAGAGCTGAAGAACATGCAAGGCCTGG
TTGAGGACTTCAAGAACAAGTACGAGGATGAGATCAACAA
GCGTGCTTCCGTAGAGAATGAGTTTGTCCTTCTCAAGAAG
GATGTTGATGCAGCCTACATGAACAAGGTTGAGCTTGAAG
CCAAGGTTGATGCTCTTCAGGATGAGATCAACTTCCTCAG
GGCAGTCTATGAGGCTGAACTCCGGGAGCTCCAGTCTCAG
ATCAAGGACACATCAGTTGTTGTAGAAATGGACAACAGCA
GAAACCTGGATATGGACTCCATCGTGGCTGAAGTTCGTGC
TCAGTATGAAGACATCGCCAACCGCAGCCGTGCCGAGGCA
GAGAGCTGGTACAAACAGAAGTTTGAGGAGATGCAGAGCA
CCGCTGGTCAGTATGGTGATGACCTCCGCTCAACAAAGGC
TGAGATTGCTGAACTCAACCGCATGATCGCCCGCCTGCAG
AACGAGATCGATGCTGTCAAGGCACAGCGTGCCAACTTGG
AGGCTCAGATTGCTGAGGCTGAGGAGCGTGGAGAGCTGGC
AGTGAAGGATGCCAAGCTCCGCATCAGGGAGCTGGAGGAA
GCTCTCCAGAGGGCCAAGCAAGACATGGCCCGCCAGGTCC
GCGAGTACCAGGAGCTCATGAACGTCAAATTGGCTCTGGA
CATTGAGATCGCCACCTACAGGAAACTGTTGGAAGGAGAG
GAGAGCAGACTGTCCAGCGGTGGAGCTCAAGCTACCATTC
ATGTTCAGCAGACCTCCGGAGGTGTTTCCTCTGGTTATGG
TGGTAGCGGCTCTGGTTTCGGCTACAGCGGTGGCTTCAGC
AGTGGTGGGTCAGGATACGGTAGTGGATCAGGATTCGGTT
CTGGATCAGGGTATGGTGGAGGCTCCATCAGCAAAACCAG
TGTCACCACCGTCAGCAGTAAACGCTATTAAGGAGAAGCC
CGTCCAAACCCCCAGCCGACACAGTTTCCAACCTTCCTTA
CCTGCAACTAGATCCCTTCTGAACCTTCTTACGACTCAAA
CCATCTATGGTGCTATATTTTAGCCAGACAGCTGTCCCCT
GTTAATGAGGAGATGTGGACGATGATTTTTTAAACACGAA
ATAAGTTTTAGATTGTTCTGTGTGTTGATGGTAGTTACCC
GTATCATGCATCTCCTGTCTGGTGGTGTCACTGCCATTTT
AAATCATCAACCCAACTACACTAAAACGATACCAGGAAGA
ATCGTGCTCCAAGCCACTGAATAGTCTTATTTCTGCACTG
ATATATACAGGGAAAGTGAGACACATAGAAACCACTGTAA
CCTACGTAGTACTATGGTTTCACTGGATCAGGGGTGTGCT
ATACAAGTTCCCGAATGTCTTGTTTGAATGTTTTGTGCTG
TTACAAGCTCCCTGCTGTAGTTTTGCTGACTAATCTGACT
TTTGTCATTTTGCTATGGCTGTCAGAGTTGGTTTACCTAT
TTTCTATAAAATGTATATGGCAGTCAGCCAATAACTGATG
ACAATTGCTTGTGGGCTACTAATGTCCAGTTACCTCACAT
TCAAGGGAGATCTGTTACAGCAAAAAACAGGCACAATGGG
ATTTATGTGGACCATCCCTCCTTAACCTTGTGTACTTTCC
GTGTTGGAAGTGGTGACTGTACTGCCTTACACATTCCCCT
GTATTCAACTGGCTTCCAGAGCATATTTTACATCCCCGGT
TATAAATGGAAAATGCAAGAAAACTGAAACAATGTTGAAC
CAGATTTATTTGGTATTGATTGACGAGACACCAACTTGAA
ATTTGAATACAATAAATCTGAGACCACAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
krt4-201 Contained in:
OTHER krt4-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024624 (1)
  • Ensembl_Trans:ENSDART00000012644 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC066728 (1) 2487bp
    GenBank:AF134850 (1) 2480bp
    GenBank:CK866917 (1) 941bp
    GenBank:CN512995 (1) 935bp
    GenBank:CT730737 (1) 850bp
    GenBank:DV592748 (1) 820bp
    GenBank:DT063116 (1) 789bp
    GenBank:CK025113 (1) 782bp
    GenBank:CT711618 (1) 768bp
    GenBank:CT670247 (1) 742bp
    GenBank:BM812114 (1) 589bp
    GenBank:AW778710 (1) 402bp
    CITATIONS (2)