ZFIN ID: ZDB-TSCRIPT-090929-7446
Transcript Name: scn8ab-202
Previous Name: scn8ab-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024623 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024623|OTTDARG00000019885|ZDB-GENE-060906-2 scn8ab|OTTDARP00000020315 scn8ab-001 LG_none CR753817.13,CR388364.11 Danio rerio protein_coding KNOWN, 6036 bp
GAAGATAGCGGCAACAATATGGCGACATCCGCAGTTTCTC
CTGGGTCTTTTAAACATCCTTAGGCACGCGAGATCTACAT
GGATCGCTCTTAATGCGGAAAAACGCTTGCTGTCCTGAAT
GGCTTCTAAATAAAGAGGACTCTGCTGCAGGATGACAATA
TGGCTGCGCCGCTGCTCGCACCTCCAGGCCCCGACAGCTT
CAAGAGGTTCACCCCTGAATCTTTGGCCAACATCGAGAAG
CGCATCGCTGAGGAGAAGAAGAAGAAGCCTGTTAAACCCA
GATCTGACAGCAGTCACCGCGATGACGATGATGACAACAA
ACCCAAGCCCAACAGTGACCTGGAAGCGGGGAAGGGCGTG
CCCTTTATTTATGGGGACGTCCCGTCTAATATGTTGGCCG
TGCCCCTGGAAGACCTGGACCCCTTCTATTTGAACAAGAA
AACCTTTATAGTGCTTAACAAAGGAAAAACAATCTTCCGT
TTCAGTGCCACGCCCTCATTATATATCATTAGTCCTTTTA
ACCTGTTCAGGCAAATAGCAATTAAAATTTTGATACACTC
ATTTTTCAGCATGATCATCATGTGTACAATTTTGACAAAT
TGTGTCTTCATGACATTCAGCAATCCTCCAGAATGGTCCA
AACAAGTAGAGTACACCTTCACAGGAATCTACACTTTCGA
GTCTCTCACAAAGATTGTGGCTCGAGGTTTCTGTATAGAC
GACTTCACCTTCCTCAGAGACCCCTGGAACTGGCTGGATT
TCATGGTCATCTCTATGGCATATGTAACAGAGTTTGTGGA
CCTGGGGAATGTGTCAGCCCTGAGAACCTTCAGGGTTCTA
CGAGCTCTCAAAACTATTTCTGTCATACCAGGGCTGAAAA
CCATTGTGGGAGCTTTGATCCAGTCAGTGAAGAAGCTGTC
GGATGTGATGATTCTGACTGTGTTTTGTCTGAGTGTGTTC
GCCCTAATCGGTCTCCAGCTGTTTATGGGTAATCTTCGGC
AAAAATGTGTCATCTGGCCAGTCAATTCAACAGAAACCTA
CCTGGCCAACGGCAGCAAGGGTTTCGACTTTAACGAATAC
ATCATGAATGATACAAACTTCTACTTCCTGCCAGGCATGT
TGGATGCACTGCTATGTGGAAACAGCTCAGATTCAGGACG
GTGTCCGGAGGGCTATACTTGCATGAAGGCTGGACGCAAC
CCAAACTATGGCTACACAAGCTTTGACTCCTTCGGTTGGG
CTTTTCTTGCTCTCTTCCGACTGATGACACAAGATTTCTG
GGAGAATCTGTACCAGCTGACTCTACGAGCTGCGGGAAAA
ACATACATGATCTTTTTCGTTCTGGTGATCTTTGTGGGAT
CGTTCTACCTGGTGAATCTGATCCTGGCTGTGGTGGCCAT
GGCCTATGAAGAACAGAACCAGGCCACCATTGAGGAGGCT
GAACAGAAGGAAGCGGAGTTTAAAGCCATGCTGGAGCAGC
TGAAGAAACAACAGGAGGAGGCACAGGCCAATGCCATGGC
GACTTCAGCAGGTACAGTGTCTGAGGACGCAGTGGAGGAC
GATGGCGGAGGGCATCTGTCCCGCAGCTCCTCTGAAGTGT
CCAAACTGAGCTCCAAGAGCGCCAAGGAGCGCAGGAACAG
AAAGAAGAAGTGGAGGAAAGAGCAGGAGGAGAAGGGAGAC
AGTGAGAAAGTAGTGAAGTCAGAATCTGATGATGGCAGCA
AGAGGAGCCGCTTCCGTTTCAGAGACAACAGGCTTGGGCG
GAAGGCCTCCATCATGAATCAGTCGCTGTTGAGCATCCCT
GGCTCGCCCTTCATGTCGCGCCGCAGCAGTATATTCAGCT
TCAAGGGCTCAGAGAACGAGTTTGCAGACGATGAGCACAG
CACGGTGGAGGAGAGCGAGGATCGCCGTGGCTCTCTCTTC
GTCCCATACAGACGCAGCAGCTACAGCGGCTACAGTCAGG
GCTCTTCTCGAATTAACCCGCTGGCTCCACACCCAGGCTG
CAAGAGAAACAGCACGGTGGACTGCAATGGCGTGGTGTCT
CTGATCGGGCCTGGACCTGGCCGACTACTGCCTGAGACAA
CAGAGGTAGAGGGGAAGAGGAAACACTCAGGTTCTCTTAT
GGTGTCCGTGGATCAGCTCAATACGTCCTTTAGCCGGAAA
GAGCGAGCAAACAGTGCAATGACTGTTGTCACCAACACAC
TTGTGGAAGAGCTGGAGGAGTCTCAGAGAAAATGTCCGCC
CTGCTGGTATAAATTTGCCAACACATTCTTGATATGGGAG
TGTTGTCCAATCTGGATAAAAATAAAGGAGATCGTGAACC
TCATAGTGATGGATCCATTTGTAGATCTGGCTATCACTAT
CTGTATTGTGCTGAACACAGTGTTCATGGCCATGGAGCAT
TATCCCATGACTCCGCGCTTCGAGGAGGTGCTTTCTGTTG
GAAACCTGGTGTTCACAGGTATTTTCACTGCTGAGATGTT
TGCAAAGCTAATAGCCATGGATCCATACTATTACTTTCAG
GAGGGCTGGAATATCTTTGATGGCTTCATTGTGAGCCTGA
GTTTAGTGGAGCTGGGGCTGGCGGATGTAGAGGGTCTGTC
TGTGCTCAGATCCTTCAGATTGCTGAGGGTGTTTAAGCTG
GCTAAATCATGGCCTACTCTGAACATGCTGATCAAGATCA
TTGGTAACTCAGTGGGAGCTTTGGGAAACCTGACCCTGGT
GCTGGCCATCATCGTCTTCATCTTTGCTGTGGTGGGAATG
CAGCTGTTTGGGAAGAGCTATAAGGACTGTGTTTGTAAGA
TCGCTGAGAGCTGTGAGTTGCCCCGCTGGCACATGAACGA
CTTCTTCCACTCCTTCCTAATTGTGTTCCGGGTGCTGTGC
GGAGAGTGGATCGAGACCATGTGGGACTGCATGGAGGTGG
CGGGACAGTCAATGTGCCTCATTGTGTTCATGATGGTGAT
GGTCATCGGAAACTTGGTGGTGCTGAACCTGTTCTTAGCC
TTGCTGCTGAGCTCCTTCAGTGCTGATAATCTGGCTGCCA
CAGATGATGACGGTGAGATGAACAACCTGCAGATCTCCGT
CATCCGCATTAAGAAAGGCATTGCTTGGTTCAAAATTCAT
GTACGGCTGCTGGTGGCCCACGTCCTGAAGAAGAAACCTC
TGGAAGATGAAGACAAACCGCTTGATGACATGTATGACAA
AAAACTGAACTTAATGGGCAACCACACCGGCGTGGAAATC
AAATGTGGTGATCTGAACTACCCCAAGAACGGGAATGGCA
CCACAAGTGGCATTGGGAGCAGCGTGGGAAAGTACATGAT
TGATGAGGAGCCCATGTCCTTCATCCACAACCCCAACCTG
ACTGTACGGGTTCCCATTGCTGTTGGAGAGTCCGACTTTG
AGAATCTGAACACGGAGGACTTCAGCAGCGAATCGGATGT
GGAAAATAGCAAAGATCTGGACGACACTAGCTCTTCTGAA
GGAAGTACTATCGATATAAAGCCTGATGAGGAGGAGATGG
CTGTGGTGGAGGTGGTGGAAGAGTACTTAGATCCAGAGGC
CTGCTGGACTGATGCTTGTGTGGCGCGCTACAAATGTTGT
GATGTGCCTATTACTGAGGGCTGGGGGAAGTACTGGTGGT
TTCTGAGGAAAACTTGCTACCTCATTGTTGAGCACAACTG
GTTTGAGACGCTCATCATTTTTATGATTCTTCTCAGCTCT
GGAGCTTTGGCATTTGAGGATGTATATATTGAACAGAGGA
AAACCATCCAGATCATTCTTGAATATGCAGACAGAGTCTT
CACATACATCTTCATCCTGGAAATGTTGCTAAAATGGGTG
GCCTATGGGTTTGTCAAATACTTCACCAATGCATGGTGCT
GGCTGGACTTCTTCATTGTGGATGTGTCTATAGTCAGCCT
TATAGCTAATGCGCTGGGCTACTCAGACTTGGGCCCCATA
AAGTCCCTGAGAACTTTGAGGGCTCTCAGGCCCCTGAGAG
CTTTGTCCCGGTTTGAGGGCATGAGGGTTGTGGTGAACGC
TTTGGTGGGTGCCATTCCCTCCATCATGAATGTGCTGTTG
GTGTGTTTGATCTTTTGGCTGATCTTCAGTATTATGGGTG
TCAACCTGTTTGCTGGAAAGTACTATTACTGCTTCAACCA
GACTGCAGAGGAGTATTTTCAAGTCGACGTTGTCAATAAC
AAGACCGAATGCTTTGCACTCATCAATGCAAACTACACAG
AAGTTCGCTGGAAGAACGTAAAGATCAATTTCGATAATGT
GGGCGCAGGTTACCTGGCACTCTTGCAAGTGGCTACATTC
AAAGGCTGGATGGACATCATGTATGCTGCTGTGGATTCCA
GAAAGGTTGAGGACCAGCCCCTTTATGAGGACAACATCTA
CATGTATATATATTTCGTCATCTTCATTATCTTTGGGTCC
TTCTTCACCTTGAACCTGTTCATTGGTGTCATTATTGACA
ACTTTAACCAACAGAAGAAAAAGTTTGGAGGTCAGGATAT
CTTCATGACAGAAGAACAGAAAAAATACTACAATGCTATG
AAGAAACTGGGCTCAAAGAAGCCACAGAAACCCATCCCTA
GACCTCTGAACAAAATCCAGGGGATGGTATTTGACTTTGT
CACTCAGCAGGCCTTTGATATTTCCATCATGATGCTCATC
TGTCTTAACATGGTAACCATGATGGTGGAAACAGATGATC
AGTCAGACGAGACAGAGAACATCTTGTATTGGATAAACTT
CGTATTCATCGTGGCCTTCACTGGCGAGTTCGTCCTGAAA
CTCTTTGCGCTGCGACACTATTATTTCACCAATGGCTGGA
ATGTCTTTGACTGCGTCGTTGTCATTCTGTCCATTGTGGG
TATGTTCCTGGCAGACCTCATCGAGAAATACTTTGTCTCA
CCAACTTTATTCAGAGTAATCCGTCTGGCTCGAATCGGCC
GAATCCTGCGTCTGATTAAAGGAGCCAAGGGCATCCGGAC
ATTACTGTTTGCTTTGATGATGTCACTTCCTGCTCTGTTC
AACATTGGCTTATTGCTTTTCCTAGTCATGTTCATCTTCT
CTATCTTTGGCATGTCCAACTTTGCCTACGTGAAGAGAGA
AATAGGAATTGACGACATGTATAACTTTGAAACCTTTGGC
AACAGCATGATCTGTCTATTCATGATCACCACATCAGCTG
GCTGGGATGGCCTGTTGGCTCCTATCTTGAACTATCCGCC
TGACTGCGACCCTAATAAAGAGAACCCAGGAACCACAGTT
AAGGGCAACTGTGGCAATCCTTCAGTGGGAATCTTCTTCT
TTGTAATGTACATTATCGTGTCTTTCCTGATTGTGGTGAA
CATGTACATCGCTATCATCTTGGAGAACTTCAGCGTTGCC
ACCGAAGAGAGTGCGGATCCACTGTGCGAAGACGACTTTG
AGTCCTTCTATGAAATCTGGGAAAAGTTTGACCCCGACGC
TTCCCAGTTCATCACCTTCGCCAAGCTGCCAGACTTTGCG
GATACATTAGAGCATCCCCTCCGTGTGCCAAAGCCAAACA
TCATCGAGCTGATCGCCATGGACCTGCCCATGGTGAGCGG
CGACCGCATTCATTGCTTGGACATTCTGTTTGCCTTTACC
AAGCGCGTGCTGGGTGACAGCGGTGACCTGGACATGATGC
GACAGCAAATGGAGGAGCGCTTTGTGGCAGCCAACCCGTC
CAAGGTGTCATATGAGCCCATCACCACCACACTACGGCGT
AAGCAGGAAGAGGTGTCAGCCATCGTGATCCAGAGATCTT
ACCGGTCCCACCTCGCGAGCAGGGGCTTCATCTGCAAACG
CAGGCCTGCCAACAACAAACTGGAGAACGGTGGGGGCAAT
CAGGAGAAGAAAGAGGGCACACCTTCCACTGCATCCCTGC
CATCCTATGACAGTGTAACCAAGCCCGAGAAGGAAAAGCA
GGACGACAACAACGAAGGCAAGGGCCGCAAGGAGAAAGGC
CGAAACCAAAAAGATGTCAGGGAATCTAAGTGTTAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
scn8ab-202 Contained in:
OTHER scn8ab-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024623 (1)
  • Ensembl_Trans:ENSDART00000151299 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DQ149509 (1) 5877bp
    CITATIONS (2)