ZFIN ID: ZDB-TSCRIPT-090929-7439
Transcript Name: rp2-001
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024616 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024616|OTTDARG00000019882|ZDB-GENE-040426-2795 rp2|OTTDARP00000020309 rp2-001 LG_ BX322552.6 Danio rerio protein_coding KNOWN, 2148 bp
GTAACGCTGTCCGCTGTAATGATTGGCTGGCTCCAGGGTC
AAGGAAACGGGAAGCGCACAGGTTGCGTGTTCTTGATTAC
TTTCTGGGGAGGAGAAGAAGCCAGAGCGCGACTGCGGCGG
ATCGACACTTTCAGAAACGCCTGGTATTTACAACCGGAGG
GGCGTGCTGACAAATAGCACAACTCGTCGTCCATAAATGG
GGTGCTTCTTCTCCAAAAAATCGAGGAGGAAATCTCCCAA
AAAAGACGCTGCTTTACCCACCGGGGACGAGAGCGCTACG
GGCAATGACCTCGCCGAAACCAACAACACTGCGCTGGGCA
GCAACAGCAACCAGGAGGCTCCAAAGCAATACAGCTGGGA
CAAACGAGAAAAGGTCGACCCCAAAGACTTTATGCTGACA
GGCCTCAAGAATGAGACCGTGGGCAGGTTACCAGGCAAGC
TCAACGGTCAGCAGTTTGTCATTCAGGACTGCGAAAACTG
TAACATATTTGTGTTGGACCATTCGGCAACTATTACCATC
GATGACTGTGTGAACTGCCGCATTGTGTTAGGTCCGGTCA
AAGGCAGTGTGTTCTTCAGAGATTGTAAAGACATCAAATG
CGTGGTGGCCTGTCAGCAGTTCCGCACGAGAGACTGCAAG
AAAATGGACGTCTTTTTGTGCTGCGCCACCCAGCCCATAA
TCGAGTCTTCTACAGGCATGAAGTTTGGCTGCTTCCAGTA
TTACTACCCTGAGCTGGCTTTCCACTTTAAAGATGCAGGT
CTCAGCATTTTTAACAACAACTGGAGCAATATTCATGACT
TCACACCTGTCTCTGGAGAAACTAACTGGAGTCTCCTGCC
AGAGGATGCTGTTGTCCTGGACCATGTGCCTCTTCCAGAT
CCTGAGTCAGAGTTCAAGTCTGTGAGAATTGCTACTGAAG
CAGGTCGGAGTATAGTGCCTCTGACTAAAGGGAGCCGGCG
AACAGAGAGCGAAGAGTCTTGTCTGTTTGTGTTCTTCGCT
GGAGACTACACCACTGCTAATGCCCGCAAGCTCATCGATG
AGGCAACTGCTAAAGGCTTTGTCCTGATTCAGACTAAAGA
GGTTTCCATGCGCCCTGAGGATGTGAGCCGAGTGTTCCAG
AATAATGCAGAGAGCCTTACTGAATGGATCACCAAAGGTC
CAGTGGTAGCGCTTGAGCTGAATGGAGACGGTGTGGTGGA
AGCGTGTCGATCCTTTGCCAATGAAGTGTTCAACGGAACA
CAGCTGTTTGTTTCTGAGAGCAAAAATACATCCTCGCGTG
ATGTTGACAACTTTTTCAACTTTGCTGACATGCAGATGGG
CCTGTGAAACTGGGGCAGAGGGTCAGCTCAATTTAACAAA
AAAAACAGAAAATTGTTCTAGGGTGGATCTGACAATTTGA
CATTTTCATGTTGATTATATTGACATATTGTCAGCGAGTT
TATTTGGATCCAATCAAGAAGGCAAGTGCCTTTAGATAGA
GTACTAGAACTAAAGTCTAATCAAACATTGCTGTGGACAA
TTTCATCGCTTATGCTGAAAATAATGAATTTGATTATATA
GATATTTATTGAATTTCCTTTTTTTTCATAAATGTATAGC
TGGAAATTGTTTTACTCTGTCTTGGCTGTATACAGTACGT
CTCCTTTACTTAGTGTATAGTCATCATGCCTGTGTATATT
TGTTAGATGTAAAAACAATATTGTTCAGATTTTGTCACAT
GCCTAAAAACATGAATTGTATTGAATTAGATTTTTTTATA
TGACCGATATAAATGTATTTTATTTTACAGTTAGCATAGC
TTTTTATTTGTATGTTTTTTTCAGTATTGTCTTGTTTTTC
AAATGACATCTGTTTTTATTGTATAAGTTTTTACAGTAGC
ACTGTTCTGAAAAGAATGTAAATGCTGAAACTGATAGGTC
GAATGTACTACTAAACAGGAGCATTAATCGTCTCCTTTAC
ATTGTTCTATTTTTCTAGGATCATTTTAAAGAGCACAACA
ACTTTTCTGTGACCAGAATCATTTGTACACTTCAAAAGAA
AAAATAGTGATTTTTTTTTTTTTCTTCTAAATGTTCCTAT
TTGTACAAGACAGTTTTTTAGGGATGAATAATAACTGTGA
TTTGTCAATACAATCATACTGATCGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rp2-001 Contained in:
OTHER rp2-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024616 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC046879 (1) 2020bp
    GenBank:CN316885 (1) 926bp
    GenBank:CO915663 (1) 876bp
    GenBank:CT682910 (1) 819bp
    GenBank:CK705736 (1) 778bp
    GenBank:DV593122 (1) 769bp
    GenBank:CT682909 (1) 767bp
    GenBank:CK677317 (1) 756bp
    GenBank:BQ260895 (1) 606bp
    GenBank:AW420616 (1) 411bp
    CITATIONS (1)