header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7428
Transcript Name: ptch2-202
Previous Names: ptc1-001, ptch2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024605 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024605|OTTDARG00000019874|ZDB-GENE-980526-44 ptch2|OTTDARP00000020299 ptc1-001 LG_ BX649493.8 Danio rerio protein_coding KNOWN, 4420 bp
TCCGCTCGCCACTTTCTTCTGCTTTAAAACGAGTTACGCG
CTATAGCTGGACGAATGAAGACCGAGGGATCTATACGGAT
TCGCGCACATAATGTTGGGATGGAGTTGGAAGACTTTGGC
TCAAGGAAAGACTAGAGAATATTTCTTGAAGTTGAACCCG
GTGGATGCGCGTGTCGCGAATCTTGGATTATTATTATTAT
CGCCTCCGTTTAACGCGCCGCGTTTGCCTTTAACTTTCTT
CAGCGCTTCTTCTGCCTCCCGTTTGGACTATGGCCTCGGA
TCCCAGAGACCCGGGACCGGCCGGTGGTGTTTTTGGAGAT
TTACCCCCAAGTTACACACGCTCTCCGCCGCCTGTGAACT
CAGATCTCCTCCGGAGACCCAGTTACTGCCACGCCGCTTT
TGCTTTAAAACAGATTTCTAAGGGAAAAGCTGTGGGACAG
AAAGCACCACTGTGGATTCGGGCGAGGTTCCAGGCTTTTC
TCTTTTCTCTGGGCTGTCACATCCAGCGACACTGTGGAAA
AGTGCTTTTCATTGGACTGCTTGTGTTCGGAGCCCTGTCT
GTTGGGTTGCGGGTCGCTGCCATTGAAACGGACATAGAGA
AACTATGGGTGGAAGCTGGCAGTCGAGTGAGCAAGGAGCT
ACGCTACACAAAAGAGAAGCAAGGAGAGGAGTCAGTGTTC
ACCTCACAGATGCTGATACAGACACCCAAACAGGAAGGAA
CTAATATTCTTACCCAGGAGGCTTTGCTGCTCCACCTGGA
GGCAGCTCTGTCAGCTAGCAAAGTTCAAGTGTCTCTTTAT
GGAAAATCTTGGGATCTTAATAAAATCTGCTTCAAATCTG
GAGTTCCAATTATAGAAAATGTCATGATTGAAAGGATGAT
TGATAAGCTTTTCCCCTGCATGATTGTGACTCCTTTGGAC
TGCTTTTGGGAAGGCTCCAAGTTGCAGGGAGGCTCCGCCT
ACTTACCGGGCATGCCTGACATTCAATGGATGAATCTGGA
TCCACTCAAGCTAATGGAGGAGTTAAGCCAGTTTACGTCT
CTAGAGGGCTTTCGAGAGATGCTGGATAAAGCTCAGGTGG
GCCATGCCTATATGAACCGTCCATGCTTAGATCCCAGTGA
CACAGACTGCCCTCACAGTGCCCCTAATAAGGACCCATGG
CAGGTCCCTAATATTGCTGCTGAACTTCAGGGTGGTTGCC
ATGGTTTCTCCAAGAAGTTCATGCACTGGCAGGAGGAGCT
GATCCTGGGCGAAAGAGTAAAGGACTCCCAGAATGCCTTG
CAGAGTGCGGAGGCCCTTCAGACAATGTTCCTCCTTATGA
GTCCCAAACAGCTCTATGAGCACTTCAAAGATGACTATGA
GATCCATGACATCAACTGGAATGAGGACAAAGCCACCGCC
ATCTTGGAGTCCTGGCAGAGGAAGTTTGTTGAGGTTGTTC
ATGGGAGCATTCCTCAGAATTCTTCCTCCAATGTTTATGC
CTTCTCTACAACCACTCTTAATGACATCATGAAATCTTTC
TCTGACGTCAGCGTAATCAGGGTGGCAGGTGGTTATCTGC
TCATGCTGGCATACGCATGCGTGACCATGCTGCGCTGGGA
CTGCGCGAAGTCTCAGGGTGCTGTAGGGCTGGCAGGAGTA
CTGCTAGTTGCTCTATCTGTGGCTGCAGGACTTGGACTGT
GTTCGCTGTTGGGACTGTCCTTTAATGCCGCCACCACGCA
GGTGCTACCATTTCTAGCCTTGGGGATTGGAGTTGACGAC
ATGTTCTTGTTGGCTCATTCCTTCACAGAGACCCGATCCA
ACATCCCATTCAAGGAGAGGACAGGTGACTGCCTGAGAAG
AACTGGCACCAGTGTGGCTCTTACCTCAATTAATAACATG
ATTGCTTTCTTCATGGCAGCCCTAGTGCCAATTCCTGCTC
TTCGGGCCTTCTCACTTCAGGCGGCTGTTGTGGTGGTCTT
TAACTTTGCTATGGTTTTGCTGATATTCCCTGCCATTCTG
AGTTTGGACCTGCATAGACGAGAGGACAAAAGACTGGACA
TCCTGTGCTGTTTCTACAGTCCCTGTTCATCTCGGGTCAT
TCAAATCCAGCCTCAAGAGCTCTCAGATGCTAATGACAAC
CATCAGCGTGCTCCAGCTACCCCCACCTACACAGGCTCCA
CTATAACCACAAGCACCCACATCACTACCACTGTTCAGGC
CTTCACTCAATGTGATGCAGCTGGTCAGCATATTGTCACC
ATCTTGCCACCCACCTCCCAGATATCCACCACTCCTCCAT
CCATGGTCCTATCCACACCAACCCCTACCACTGACCCTTA
TGGCTCTCAGGTGTTCACCACTTCCAGCTCCACCCGAGAC
CTTCTAGCCCAGGTGGAAGAGCCCAAAGAGGGCCGTGAGT
GTGTGCCTCTTCCCTTCTTTCGCTGGAATCTGTCAAGCTT
TGCAAGAGAAAAGTATGCCCCTCTGTTGCTGAAGCCTGAA
ACTAAGACTGTGGTGGTTGTTGTTTTTGTGGCTCTTTTAA
GCCTCAGCCTCTATGGTACCACAATGGTTCACGATGGACT
CTACTTGACTGATATTGTCCCTAGAGACACACAGGAGTAT
GAATTCATTACAGCTCAGTTTAAATACTTCTCCTTCTATA
ATATGTACCTGGTTACCATGGATGGCTTTGACTATGCCCG
TTCTCAAAGACAGCTTCTACAACTTCATAATGCCTTTAAC
TCTGTGAAATACGTAGTTAAGGATGGCAATCACAAACTTC
CCAGAATGTGGCTGCACTACTTCCAGGATTGGCTCAAAGG
TCTGCAAGCCACTTTTGATGCTGATTGGGAAGCTGGCAAA
ATTACCTATGACAGCTATCGCAATGGCACAGAGGATGGAG
CACTGGCCTACAAGCTTCTTATACAAACTGGCTCTAAGAA
AGAACCTTTCAACTACAGCCAGCTCACATCTCGCCGCCTG
GTGGATGAGGACGGTCTTATTCCTCCAGAGGTTTTTTATA
TCTACCTGACAGTATGGGTCAGTAATGATCCACTGGGCTA
TGCTGCCTCCCAAGCCAACTTTTACCCCCATCCTCGGGAG
TGGATCCATGATAAGTACGACACCACTGGAGAGAACCTTC
GCATCCCTGCGGCAGAGCCTCTAGAGTTTGCACAGTTTCC
TTTCTACCTAAATGGACTAAGACAAGCCTCAGACTTTATT
GAAGCCATCGAGAGCGTGCGCACAATCTGTGAGGAGTTCA
TGCGTCAGGGAATCAAGAACTATCCCAATGGCTACCCCTT
TTTGTTTTGGGAACAGTACATTGGTCTGCGCCACTGGTTC
TTACTGTCCATCAGTGTAGTGCTTGCCTGCACCTTCCTGG
TGTGTGCCATCCTCCTGCTCAACCCCTGGACCGCAGGCGT
CATTGTTTTTATTTTGGCCATGATGACAGTGGAACTTTTT
GGCATTATGGGCCTAATTGGTATCAAGCTGAGTGCTATTC
CTGTGGTCATCCTTATAGCCTCTGTTGGTATTGGAGTGGA
GTTTACTGTGCACATTGCACTGGGTTTCCTAACTGCCATT
GGGGACAGGAACACTCGTTCAGCCGTTGCTATGGAACATA
TGTTTGCTCCTGTGATTGACGGCGCCATCTCCACTCTTTT
GGGAGTGCTTATGCTTGCCGGCTCAGAGTTTGACTTCATC
ATGAGATACTTCTTTGCTGTGCTGGCCATACTGACGTTGT
TGGGGATCCTGAATGGTTTGGTTCTACTTCCGGTACTTCT
TTCACTCATGGGCCCCCCAGCTGAGGTTGTACCTGCTAAC
AACGCAAATCATTTGCAAAGTCCTTCTCCTGAGCCCATGC
CTCCTCCTATGAACCACCATGGGTACTACGCTGGGCACAT
CCCCAAGGCATCACATCAGGCATTCTCTGAGACCTCTGAC
TCTGAGTACTATTCTGAAACGACGACCACCTCTGGCATCG
GGGAGGAGGAATACAAGTACTGTGACAGGAGCACATACAT
CACACCTCCAGCTCAACCTCCAACCACTCATATTCTGCTT
GAAGCCAGCAAAAACCCCAGCTTCCCTAAGCTCACAGTGG
TGAAACCATTTCATGAAGTACAGAACTGCGAGACTAAGCA
GAATGCTGTCAACTCCATCAGCTCACAGATCAAACGGTGG
GACAATAAAAATGAGGACCAGGGGCAGAGGAGACAACATT
TACCTACTGACAGGACAAACTGTCAGCGTAGGACTACTCA
ATGTGGCCCAGGGCCACAACAAGGAACAGGGCAGCAGCAA
AACAGGACTACAGCCCATACAGGGGCATTGCAGCACCCTA
ATAATGCCATCACCATGGTTACAGCAACAGCCTCTGTGAC
AGTGGCAGTGCACCCCAGTTTGCCGGGGTCATACCAGGGT
TACATGCATGAAGGGTTTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ptch2-202 Contained in:

OTHER ptch2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024605 (1)
  • Ensembl_Trans:ENSDART00000140910 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CR929646 (1) 539 bp
    CITATIONS (2)