header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7399
Transcript Name: ntn1b-201
Previous Name: ntn1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024569 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024569|OTTDARG00000019852|ZDB-GENE-990415-168 ntn1b|OTTDARP00000020271 ntn1b-001 LG_ BX120006.15 Danio rerio protein_coding KNOWN, 1809 bp
ATGATAAGGATTTTGGTAACGTGCGTCTCCATGGTGTCCA
TCACCTCGATGGTGTCCGGTGCTCGCGGTGGATACGGGAT
GAGCATGTTCGCGGCTCAGTCCTCTCCTCCGGACCCGTGC
TACGACGAGAACGGGAACCCCAGACGCTGCATCCCCGACT
TCGTGAACTCCGCTTTCGGGAAGGACGTGCGCGTGTCCAG
CACCTGCGGCTCTCCTCCGTCGCGCTACTGCGTGGTGACC
GAGAAAGGCGAGGAGAGATCGAGGGACTGCAACATCTGCG
ACGCCACAGACCCCAAAAAGACCCATCCGCCCGCATACCT
GACAGACCTCAACAACCCTCATAACCTCACCTGCTGGCAG
TCGGAGAACTACGTGCAATACCCGCAGAACGTGACTCTGA
CTCTGTCTTTGGGGAAGAAGTTTGAAGTGACTTATGTGAG
CCTCCAGTTCTGCTCTCCTCGCCCCGAATCCATGGCCATC
TTCAAATCCATGGACTATGGGAAAACCTGGGTGCCTTTTC
AGTTCTACTCAACCCAGTGCAAGAAAATGTACAACAAGCC
CAGCAAAGCTGCCATCACCAAGCAGAACGAGCAGGAGGCG
ATCTGCACGGACTCTCACACGGACATGCAGCCGTTAACCG
GCGGCCTCATCGCGTTCAGCACGCTGGATGGCAGACCGTC
CGCGCACGACTTCGACAACTCGCCCGTCCTGCAGGACTGG
GTCACGGCCACCGACATCAAAGTGACCTTCAACCGGCTGC
ACACGTTCGGGGATGAGAACGAGGACGATTCGGAGCTCGC
CAGGGACTCGTATTTTTACGCGGTGTCTGACCTGCAGGTC
GGTGGACGGTGTAAGTGTAACGGGCACGCGTCGAAGTGCG
TGAAGGACCGGGAAGGAAACCTAGTGTGCGAATGCAAGCA
CAACACTGCGGGACCAGAGTGTGACAGGTGTAAACCCTTC
CACTACGACCGGCCCTGGCAGCGCGCGACTGCCAGAGAGG
CGAACGAGTGTGTCGCTTGTCACTGTAACCTACATGCCCG
CCGCTGCCGCTTCAACATGGAGCTGTATAAGTTGTCAGGC
CGCAGGAGTGGAGGAGTCTGCCTGAACTGCAGACACAACA
CCGCCGGACGCCACTGCCACTACTGTAAAGAGGGCTACTA
CAGAGACATGAGCAAGGCTATATCACACCGACGTGCATGC
AAAGCCTGCGATTGTCATCCTGTTGGTGCAGCTGGTAAGA
CCTGTAACCAGACAACTGGACAGTGTCCATGTAAAGATGG
TGTGACTGGCATCACCTGTAATCGCTGTGCTAAAGGATAC
CAGCAGAGCAGATCACCCATCGCCCCCTGTATCAAAATTC
CAGTTGCTGCTCCCACATCATCATACAGCAGCCCAGACGG
GCCCACAGATTGCGACTCGCACTGCAAAGCACCCAAGGGC
AAGATGAAGGTCACCATGAAAAAATACTGCAAGAAAGATT
TTGCTGTCCAGGTGCACGTGCTGAAAGGAGACAAGGCAGG
TGAATGGTGGAAATTCACCATCAACATCATATCGGTGTAT
AAGCAGGGTGGACACCGCATCCGCAGAGGAGACCAGCTCC
TGTGGGTCAGGGCAAAAGACGTTGCCTGCAAGTGCCCCAA
AATCAAACCCGGGAGGAAGTACCTGCTGATGGGCTCCGAT
GAGGAGGAGGACTCGCGTGGGCAGAGCGGTGTGGTGGCGG
ACAGGGGCAGCCTACTCATCCCCTGGAAAGACCTGTGGGC
CCGTCGCCTCAGAAAGTTCCAGCAGCGCGACAAGAGAGGG
AAGTGCTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ntn1b-201 Contained in:
[BAC] DKEYP-21H4 (1)

OTHER ntn1b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024569 (1)
  • Ensembl_Trans:ENSDART00000039482 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF017420 (1) 1809bp
    CITATIONS (2)