ZFIN ID: ZDB-TSCRIPT-090929-7397
Transcript Name: grb2b-202
Previous Names: grb2-002, grb2b-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024567 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024567|OTTDARG00000019850|ZDB-GENE-040426-1975 grb2b|OTTDARP00000020269 grb2-002 LG_ BX465842.5 Danio rerio protein_coding KNOWN, 777 bp
ATGCCAGTTGTATCGCGGGGCGCGGCCCATTGAACAATCT
AGAACACTTATATGAAACACATCGAGTTTTATAGGATTCT
TTAAAAGAGTGTATTTTGTTTACAGGTTTCTCGGCGTGAT
CTTTATGTGAGGATCGCGACGGGAGGACAGACGCGGGCTG
AGAGAGAGAGGCAGGTGGAGATCATTGTGTCTGCTTGGAT
CTGTGCTCATCATCGCTATTGAGATCTCATTGTCTGGTCC
TCTGGTCCACAATAGGGATATAAACTGCACCAGGGGGCAT
TTTCCGCTGCTTTATACCTTACAACACTGGTGTCCGTTTG
GCTGAATCATGGAGGCCATTGCCAAGTATGATTTCAAAGC
AACTGCAGATGATGAGCTGAGTTTTAAACGTGGGGAAATA
TTGAAGGTATTAAATGAAGAGTGCGATCAGAACTGGTATA
AGGCAGAACTAAACGGCAAAGACGGTTTCATTCCTAAAAA
CTACATTGAGATGAAGGCACATCCGTGGTTTTTCGGGAGA
ATCCCCAGAGCCCGAGCGGAGGAGATCCTGAACAAACAGA
GGCATGACGGAGCTTTTCTCATCAGAGAGAGCGAGAGTGC
GCCTGGAGACTTCTCACTGTCTGTCAAGTTTGGTAATGAT
GTTCAGCACTTCAAAGTGCTTCGTGACGGTGCTGGAAAGT
ACTTCCTCTGGGTGGTGAAGTTTAACTCTCTGAATGAGCT
GGTGGATTATCACCGCACCACTTCTGTTTCCAGAAACCAG
CAGATCTTTCTCCGAGA

grb2b TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA grb2b-202 777
grb2b-203 (1) 1490
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
grb2b-202 Contained in:
OTHER grb2b-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024567 (1)
  • Ensembl_Trans:ENSDART00000136495 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:DN832822 (1) 787bp
    CITATIONS (2)