header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7365
Transcript Name: eve1-201
Previous Name: eve1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024514 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024514|OTTDARG00000019817|ZDB-GENE-980526-69 eve1|OTTDARP00000020226 eve1-002 LG_ BX927395.19 Danio rerio protein_coding KNOWN, 1241 bp
GAACTTGGCTTGGAAGAGAAACAGTGACGAGAGAGAATTG
CTATTTTTTTAGTAGGGCCTGGTTTGGGAGTGTTTTGAGG
ACTATGAGAAATTAGTGAAAATCAATTACAGGAGTATTTG
GATTGCGGAAGTGGATCCTAACGACAAAATGCTAGCAGAG
GACAGGGAGTCACCAGTGTCTACTGTTGCTCATGCTGACA
GTGACCAAGGAGAGGAAGAATGCCCTCGTATTTCACTACT
GAATGGTATCGACCAAAGTCGGCGGCACCGGACAGCTTTC
ACGAGGGAACAGCTGACTCGTCTTGAGCAAGAATACTGCA
AAGAAAGTTACGTGTCTCGACCCAGGCGATGCGAACTGGC
GGCAGCCCTTAACTTGCCCGAGACCACAATAAAGGTCTGG
TTCCAGAACCGGAGAATGAAGGACAAGAGACAACGTCACA
GTCTACACTGGCCAAATCCACTGGACCCGAACCTGTGTGC
CTTCATGGTGGGTCAGACGGCTGCTGCTCTTCCCTACCCA
CTGCTGCCCCGCTTACCCATTCATCTATACTCTCATTTGG
GCATGGGTAGTCTCTCTGGGTTTTCAACCCCCTACAGCGC
CACCACAAGGCCAGTGGATACTTTGCACCTGCCTCCATCG
ACCTACCCCTGGTTAGGTGGTCTTCCACAACCAGCTCTCT
ATTCCCCCGTCCAGACAATGCATCATCCAGTAGGATGCCA
CTGTCCTCAATGCCTGCAATGGAGACCGGACCACCTGCTT
AAACCTAGAGGGGGAGCTAGGACAGGCCTACAACCCCAAA
CCTTTGGCAGTGCTTCAGGATGATAGGACAGAAGCGTCTT
TGCCATATTAAAAGCAATAGGCTACGCAGAAATGAAATTT
GTTTATCGTTTACACTCCTGTGTCATTCCAGACCTGAATG
ACTAACTGACTTGTTCTCTCTGGGATAAGAAAAAATACAT
TTTGAAGATGGTTTTGCCCATACACTGAAAGTTTAAAGCT
GTTGTATTTATGCATCTGTAAACTTATTCAGAACTGGAAA
AACATCAGGATTGAAGAGCTGTTTTGTTGTAATCTTTTTG
TATTATAGTTAAAAGTTTTGCTTACTTTTCTAAACAAATA
AGTTTGTTAATTTTTCATAATGACTGTTTTGCACCTGAAC
ACTGATACAAACCCATGTACATATGCTTTCCAAAATATAT
ATGACAATATGGACTATTAAAATATTTATGGAAACATTTT
A

eve1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA eve1-201 1241
eve1-202 (1) 1314
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eve1-201 Contained in:
OTHER eve1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024514 (1)
  • Ensembl_Trans:ENSDART00000078425 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC071289 (1) 1269bp
    GenBank:CV487834 (1) 815bp
    GenBank:CT635248 (1) 796bp
    GenBank:CK679792 (1) 564bp
    GenBank:CB365379 (1) 518bp
    CITATIONS (2)