header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-7364
Transcript Name: eve1-202
Previous Name: eve1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024513 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024513|OTTDARG00000019817|ZDB-GENE-980526-69 eve1|OTTDARP00000020225 eve1-001 LG_ BX927395.19 Danio rerio protein_coding KNOWN, 1314 bp
CGACCTGAAAGATGCAGAGGTGAGGGAGGAGGGGGGTGGA
CAGCGACTACAAAAACAACTCATCTTTCCTTTCATAAACG
AACTTGGCTTGGAAGAGAAACAGTGACGAGAGAGAATTGC
TATTTTTTTAGTAGGGCCTGGTTTGGGAGTGTTTTGAGGA
CTATGAGAAATTAGTGAAAATCAATTACAGGAGTATTTGG
ATTGCGGAAGTGGATCCTAACGACAAAATGCCAGAGGACA
GGGAGTCACCAGTGTCTACTGTTGCTCATGCTGACAGTGA
CCAAGGAGAGGAAGAATGCCCTCGTATTTCACTACTGAAT
GGTATCGACCAAAGTCGGCGGCACCGGACAGCTTTCACGA
GGGAACAGCTGACTCGTCTTGAGCAAGAATACTGCAAAGA
AAGTTACGTGTCTCGACCCAGGCGATGCGAACTGGCGGCA
GCCCTTAACTTGCCCGAGACCACAATAAAGGTCTGGTTCC
AGAACCGGAGAATGAAGGACAAGAGACAACGTCACAGTCT
ACACTGGCCAAATCCACTGGACCCGAACCTGTGTGCCTTC
ATGGTGGGTCAGACGGCTGCTGCTCTTCCCTACCCACTGC
TGCCCCGCTTACCCATTCATCTATACTCTCATTTGGGCAT
GGGTAGTCTCTCTGGGTTTTCAACCCCCTACAGCGCCACC
ACAAGGCCAGTGGATACTTTGCACCTGCCTCCATCGACCT
ACCCCTGGTTAGGTGGTCTTCCACAACCAGCTCTCTATTC
CCCCGTCCAGACAATGCATCATCCAGTAGGATGCCACTGT
CCTCAATGCCTGCAATGGAGACCGGACCACCTGCTTAAAC
CTAGAGGGGGAGCTAGGACAGGCCTACAACCCCAAACCTT
TGGCAGTGCTTCAGGATGATAGGACAGAAGCGTCTTTGCC
ATATTAAAAGCAATAGGCTACGCAGAAATGAAATTTGTTT
ATCGTTTACACTCCTGTGTCATTCCAGACCTGAATGACTA
ACTGACTTGTTCTCTCTGGGATAAGAAAAAATACATTTTG
AAGATGGTTTTGCCCATACACTGAAAGTTTAAAGCTGTTG
TATTTATGCATCTGTAAACTTATTCAGAACTGGAAAAACA
TCAGGATTGAAGAGCTGTTTTGTTGTAATCTTTTTGTATT
ATAGTTAAAAGTTTTGCTTACTTTTCTAAACAAATAAGTT
TGTTAATTTTTCATAATGACTGTTTTGCACCTGAACACTG
ATACAAACCCATGTACATATGCTTTCCAAAATATATATGA
CAATATGGACTATTAAAATATTTATGGAAACATT

eve1 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA eve1-201 (1) 1241
eve1-202 1314
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
eve1-202 Contained in:
OTHER eve1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024513 (1)
  • Ensembl_Trans:ENSDART00000140264 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CV487883 (1) 820bp
    GenBank:CT593422 (1) 766bp
    GenBank:CK676928 (1) 650bp
    GenBank:BQ074348 (1) 547bp
    GenBank:CT635249 (1) 467bp
    GenBank:CT593423 (1) 464bp
    CITATIONS (2)