Transcript

gfi1ab-201

ID
ZDB-TSCRIPT-090929-7360
Name
gfi1ab-201
Previous Names
  • gfi1.2-001
  • gfi1ab-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024495 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024495|OTTDARG00000019805|ZDB-GENE-040116-8 gfi1ab|OTTDARP00000020209 gfi1-001 LG_ BX004878.8 Danio rerio protein_coding KNOWN, 1228 bp
CTAATGACTGGGGACATATGAGGCAGAGGAGGACACAATG
CCTAGGTCTTTCTTGGTGAAGAGCAAAAAAGCGCACAGCT
ACCACCAGCCGCGATCTTTGGAGGATGACTTCAACAGACT
TGATAATATTTTGGCTCATATATGTGCAGAAAGTAAAACT
TCAGACGAGTCGGAGTGCTGTGCGGATGCTCTGACAGGCG
ACACGACTGGCGCTGGTTCACCAGACTCTCACCTTCTGGA
TCAAGCTGATCTTTCCTCCAAGTCTCCTCTCAGCTGTGAG
GAAAGCGTGTGCGATCGCTCGTCAGATTACGAGGACTTTT
GGCGACCACCATCACCATCAGCATCACCGGAGTCGGAAAA
GTCTTTTTCACCCTCCGTGGAAGAAACACAGCCCTTCGCT
GTACCCTTCAGGCCTTACGCTTGGAGCAGGTACTCGGGGT
GTGAAATCAGGCAGCTGGTCCAACATACCCTCAACCATCA
CCGCTCTCTGGATCTCGAGCGGCCTACTCCAACCTATTAC
AATGAGCGCGTGACCGAGCCCTCTATTTTCACCGAACGAG
GATCTGGCGCAAGAATTTACAACAGCTATGGCTCCACTGC
CTCTTTGTTCGAGCGCGCCACTGCTTCTGGACTCTTTGAT
GATAGCAGCATGTTGGGAAAAGGAACTGAGATGAAGTCCA
GCTCTGATGTGATCTGCAGTCGTCTCCTGTTAAATGGCGC
ATACAAATGTATAAAATGCAGCAAGGTGTTTTCTACACCC
CATGGCTTGGAAGTTCACGTCCGGAGGTCGCATAGTGGAA
CAAGACCGTTCGCTTGCGACATTTGCGGGAAAACGTTCGG
ACACGCGGTCAGCCTGGAGCAACACAGAGCTGTTCACTCA
CAGGAGAGAAGTTTTGATTGTAAAATCTGCGGGAAAAGCT
TTAAAAGGTCTTCCACCCTGTCCACTCATCTCCTTATACA
CTCCGACACACGGCCCTACCCGTGCCAATACTGCGGGAAG
AGGTTTCACCAGAAATCAGATATGAAGAAACACACATTTA
TCCACACAGGGGAGAAGCCACACAAATGTCAGGTGTGTGG
AAAAGCATTCAGTCAGAGCTCCAATCTGATAACGCACAGT
CGGAAACACACTGGATTCAAACCGTTTGGATGTGACCTTT
GTGGAAAAGGATTCCAGCGCAAGGTTGATTTAAGAAGACA
TAAGGAAACACAGCACGGACTGAAGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations