Transcript

yes1-002

ID
ZDB-TSCRIPT-090929-7342
Name
yes1-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024476 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024476|OTTDARG00000019793|ZDB-GENE-050126-1 yes1|no_translation yes1-002 LG_ BX927088.11 Danio rerio protein_coding KNOWN, 328 bp
CCCACACAGAAGTACCGACCAGATCCCACCAATCCCACCC
CTGGGTCACACATGGGCCTCTATGGACCAGACCCTACTCA
GATGGGTCAGTCACCAGCCCTGAAGGGTCCCACCAACAAC
TATAACAGCCGCTCCTCTGGTCTCACCCCATTCGGTGGCT
CTTCCTCTGTCATCACACCCTTCGGTGGAGCCTCGTCCTC
CTTCTCCACGGTGGCAGTGAACAACCCTTTTCCTGGTGTC
GTCACAGAGCATGCAGATGGGCTGTGTTATCGACTCACTA
CAGTGTGTCCGACGGTGAAGCCCCAAACTCAGGGTCTGGC
TAAAGATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations