Transcript

ttc4-201

ID
ZDB-TSCRIPT-090929-7313
Name
ttc4-201
Previous Names
  • ttc4-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024447 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024447|OTTDARG00000019778|ZDB-GENE-040426-1021 ttc4|OTTDARP00000020175 ttc4-001 LG_ BX088595.7 Danio rerio protein_coding KNOWN, 2024 bp
AGATGTTTGCTGAGAGCATGTGGATCTTTGCTACGGTTTG
TACAGTTTTATCCTATTTTACGTTTAATGTTTAGTTCCTC
TACAATTGCGATCTGAACGCGGTGACGTAGTGAGATACGT
CAAGAACTACCTGGGATACACTTCAGAATAAATTTAAGGA
GATAACATGGCTGCACCAACGCAAGGGGAAGACAGCGACG
ATGGCATGGACGAATTTATGGAGAAGTTTAAAACACAGAA
ATACCATAATGCGTTCAACGAAAGCAACTGGGAGGAGGAG
TTTGAAAAAGTTCCCATGTTCATGAAGACAGCGCCAGAAA
ACATTGACCCAGAGAAACACCCTGATCTCGCCTGTATCCA
GCATATTATCCACGATGATGACAGAACTCCTGAAGAGAAA
GCCAGAAGTCTCAAGGATGAGGGGAATGAATACTTCAAGG
AGAAGAAGTACAAGAAAGCTGTTGTTTCCTACACAGAAGG
ATTGAAAACGAGCTGTGTGAATCCTGAACTCAATGCCGTT
TTGTACACCAACCGTGCAGCTGCACATTTCCATTTAGGAA
ATATGCGTTCGGCTTTAAATGATGCCACAGCTGCAAAAAA
ATTGAAGCCAGACCACAATAAAGCCATTATAAGAGGAGCA
CAGTGCTTGCTGGAGCTGCGTAATTACGCTGGAGCGTTAC
AGTGGTGTGATGAAGGTCTAAAGTTGTTTCCCACTGACAA
GAAACTACAGGAGCTGAGAGCCACAGCTGATAAACAGAAG
AGAGAAGCTGACAGAGATGCCAGGAAGGCGAAGGTTAAAG
CGAAGAAGCAGCAGAATGAGAAAGAAGCATTGTTAGCTGC
CATTAAGGAGCGAGGAATTAAACTCCTGAAGACAGAAAAG
CCTCCTCACAGGGCTTCAGACAGCGAGGATGAGGATAGAG
ATGAAGACACCTCTAGGGCTCTGGCTGATCTTCAGCTTGA
TGGAATCAGCTCACAGGAGGCAACAGGCGCTCGGGTTTAT
ATGGATGAACAGGGTGTCCTTCACTGGCCAGTGATGTTCC
TTTATCCTGAGCACAGCCAGACAGACTTCATTTCTGCTTT
CTCAGAGAACGCCAGCTTCATAGATCATTTGGCGGTGATG
TTTGGTGAAGAGCTTCCTCCCTGGGATATAGACCAAAAAT
ATCAGCCACAGAATCTGCAGATGTTCTTTGAAGATCCTGA
AAAAGGAAACCTTTATCAAGTTGATCTTCAAGAGTCACTT
CTTAGAGTTCTACAGCACCAAAGGTGCTCGGTGAAGGCAG
GAACTCCTAGTTTCATTGTGCTGGTATCAGAATCTCCGTT
TTCTAGGCAGTTCTTATCAGGAAAAAAGGTGCAGAGATTA
AAATTATTGAAATGATCTGGAATGACCTTAAAAGTCTTTA
AATGCCTTTGTCATTATTCAACCTACTACTATAAAAAAAC
ATTGCTGCTCTCACACCTCTTAAGAAAACTCCCCCTTGAA
CTTTGAGGTGCAGTTCTTCTCCTCCATATCAGTGATTTAT
TCTTATTAAAAATGTTCCACCAATTTTCTATTACTGTAAT
GTCAACCGAATCACTGATTGAGATCAGCTAAACTTTGCAG
TACTTTTGATGGATGACAATGCATGGCAGTTTTTTTTTTT
TCAACATGTTAGTATTTTACTGAAGTATTTACCATTTTTA
CTATGGCACTCTGGATTTACAGCAATAGCCCACCACCGAA
AAAAAAGACATTTCTGTCATCATTAATCCTACAAACTTTG
CTTTGTAGAACAAAAAGAAAGATTTTTTAAGATTGTTAAC
TTTTTGTTAGTTCTACAGAAGGCTTACAGTTTTGAAATAT
TGTAAAGGTAAACTATCATAAAATTTCCACCAAATTATCA
TGTTTTTGGGTGGAGATTTTTTTTGTTGCTACATTTCTTC
TTATGGTCACTTGTTAGACCTAATTATGTTAAAAGCAACA
CATTTTTACACTGTGATATAGTTTTCATGCAATTTCAATA
AACCATTTGCACCCGATCCAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations