Transcript

pars2-201

ID
ZDB-TSCRIPT-090929-7312
Name
pars2-201
Previous Names
  • pars2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024446 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024446|OTTDARG00000019777|ZDB-GENE-030131-4219 pars2|OTTDARP00000020174 pars2-001 LG_ BX088595.7 Danio rerio protein_coding KNOWN, 1711 bp
AGAAGAAAAAGGTCATCGTTCTGTCACATGCGACGTTTTA
GTTGTGTTTTATTGATGTACAAAATCATAAGCGCCCAAAC
AATGATCTTGGTTTGATCTGACGGTATTTGTGTAAAATAT
ACGCTGGAAACAAAACATAACTTACGAATAATTGTCAAAA
ATGGAGTCAGTTATGCATCACTGCCATCGCAAGCTCCCAA
CCCTCCTGTCCAGAACTCTCTTTAAAACATTAAAGAGAAG
ACACCTCAACCTCACCATCCACACTGTTTCTGCCTCTTCC
AAACCAGTCATCCCAACACCGCTCGTGTCTCGCCTCTTCC
AGCCATCAAACCTCCGGGAAGGTCAGGATGGAGGAGACCT
GACATGTCGGAGTCAGAGACTGATGATGCAGACTGGACTG
ATCCATCCGTCAAACCCCGGCTGCTTCTATTACTTGCCTG
TGGCTCTGAGGTCCTTGGAGAAGCTGGTCCGGCTCATTGA
TGAGGAGATGCATGCGATCGGTGGGCAAAAAGTGGACATG
CCAGCGCTCTGCAGTGCAGAACTGTGGAAGAAAAGTGGTC
GCTGGGAGCTCATGGGAAAAGAGATGTTCAGACTGCTGGA
TCGGCACAATGGGGAATACTGTCTCGGACCGACTCACGAA
GAAGCAGTCACTGAGCTTTTTGCCTCCCAGACCACCATGT
CTTACAAGAAGCTGCCACTTCTGCTTTACCAGGTAACACG
CAAATTCCGTGATGAGCAGAAGCCAAAATTTGGACTCTTA
CGTGGTCGGGAATTTTACATGAAAGACATGTATTCATTTG
ACATTAATGAGGAGGCAGCTCTCCACACATACAACTCTGT
GTGCCAAGCGTATGGACGCATATTCGACCGACTGCACTTA
AAGTGGGTGCAGGTCCAGGCTGACACTGGAAACATAGGAG
GCACACTTTCCCATGAGTTTCAGCTGCCAGCAGACATTGG
CGAAGACAAGTTACTTGTTTGTGGAAACTGCGGCTTCTCT
GCCAACATTGAGACCCTGGAACCAGGACAGGCCGAGTGCT
CGCAGTGTCAAACAGGCAAACTGACTGAATCCAGAGGCAT
TGAAGTGGGCCACACTTTTTACCTCGGCACTAAATATTCA
CAGGCGTTTAAAGCACTTTTTGTTAATGCATCCAATGTGC
CTGCGGTGGCAGAGATGGGATGTTTTGGACTTGGTGTCAC
TCGAATACTAGCAGCTTCTATAGAGGTGATGTCCACAGAG
GATGCCATTCGCTGGCCTGGATTGATAGCTCCCTATCAAG
TGTGTGTCCTGCCACCTAAAAAGGGAAGTAAAGCACATGA
AGCCACACTGAAGGCTGAGGAACTGGCTCAAAGCTTGGGA
AATAGTCTTCCAAATTTGAAAGGTGAGGTGGTACTGGATG
ACAGGACTCAAATGACCATTGGGAAACGACTGAAGGATGC
TAAAATTCTGGGGTATCCATTTGTGGTGGTGGTGGGCCAG
ACGGCTCTAGATGATCTGGCCAGCTTTGAGGTGGTTTGTC
AGCAAAGTGGAGAGACTCTCTTTTTGAGTAAAGATGGGCT
TGTTGATCTTTTAAGTACGGTTGAAACTATCTAATATATG
TGTACATTTATCAGGCTAGGTGATGGTGAAGAGAAAAAGA
GTGTGATGTATAAATATTATAAGTGTTATAACAAGAAAAT
GTTGATTATTAAAGTGGTCTGTTTGTAACAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations