ZFIN ID: ZDB-TSCRIPT-090929-7312
Transcript Name: pars2-201
Previous Name: pars2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024446 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024446|OTTDARG00000019777|ZDB-GENE-030131-4219 pars2|OTTDARP00000020174 pars2-001 LG_ BX088595.7 Danio rerio protein_coding KNOWN, 1711 bp
AGAAGAAAAAGGTCATCGTTCTGTCACATGCGACGTTTTA
GTTGTGTTTTATTGATGTACAAAATCATAAGCGCCCAAAC
AATGATCTTGGTTTGATCTGACGGTATTTGTGTAAAATAT
ACGCTGGAAACAAAACATAACTTACGAATAATTGTCAAAA
ATGGAGTCAGTTATGCATCACTGCCATCGCAAGCTCCCAA
CCCTCCTGTCCAGAACTCTCTTTAAAACATTAAAGAGAAG
ACACCTCAACCTCACCATCCACACTGTTTCTGCCTCTTCC
AAACCAGTCATCCCAACACCGCTCGTGTCTCGCCTCTTCC
AGCCATCAAACCTCCGGGAAGGTCAGGATGGAGGAGACCT
GACATGTCGGAGTCAGAGACTGATGATGCAGACTGGACTG
ATCCATCCGTCAAACCCCGGCTGCTTCTATTACTTGCCTG
TGGCTCTGAGGTCCTTGGAGAAGCTGGTCCGGCTCATTGA
TGAGGAGATGCATGCGATCGGTGGGCAAAAAGTGGACATG
CCAGCGCTCTGCAGTGCAGAACTGTGGAAGAAAAGTGGTC
GCTGGGAGCTCATGGGAAAAGAGATGTTCAGACTGCTGGA
TCGGCACAATGGGGAATACTGTCTCGGACCGACTCACGAA
GAAGCAGTCACTGAGCTTTTTGCCTCCCAGACCACCATGT
CTTACAAGAAGCTGCCACTTCTGCTTTACCAGGTAACACG
CAAATTCCGTGATGAGCAGAAGCCAAAATTTGGACTCTTA
CGTGGTCGGGAATTTTACATGAAAGACATGTATTCATTTG
ACATTAATGAGGAGGCAGCTCTCCACACATACAACTCTGT
GTGCCAAGCGTATGGACGCATATTCGACCGACTGCACTTA
AAGTGGGTGCAGGTCCAGGCTGACACTGGAAACATAGGAG
GCACACTTTCCCATGAGTTTCAGCTGCCAGCAGACATTGG
CGAAGACAAGTTACTTGTTTGTGGAAACTGCGGCTTCTCT
GCCAACATTGAGACCCTGGAACCAGGACAGGCCGAGTGCT
CGCAGTGTCAAACAGGCAAACTGACTGAATCCAGAGGCAT
TGAAGTGGGCCACACTTTTTACCTCGGCACTAAATATTCA
CAGGCGTTTAAAGCACTTTTTGTTAATGCATCCAATGTGC
CTGCGGTGGCAGAGATGGGATGTTTTGGACTTGGTGTCAC
TCGAATACTAGCAGCTTCTATAGAGGTGATGTCCACAGAG
GATGCCATTCGCTGGCCTGGATTGATAGCTCCCTATCAAG
TGTGTGTCCTGCCACCTAAAAAGGGAAGTAAAGCACATGA
AGCCACACTGAAGGCTGAGGAACTGGCTCAAAGCTTGGGA
AATAGTCTTCCAAATTTGAAAGGTGAGGTGGTACTGGATG
ACAGGACTCAAATGACCATTGGGAAACGACTGAAGGATGC
TAAAATTCTGGGGTATCCATTTGTGGTGGTGGTGGGCCAG
ACGGCTCTAGATGATCTGGCCAGCTTTGAGGTGGTTTGTC
AGCAAAGTGGAGAGACTCTCTTTTTGAGTAAAGATGGGCT
TGTTGATCTTTTAAGTACGGTTGAAACTATCTAATATATG
TGTACATTTATCAGGCTAGGTGATGGTGAAGAGAAAAAGA
GTGTGATGTATAAATATTATAAGTGTTATAACAAGAAAAT
GTTGATTATTAAAGTGGTCTGTTTGTAACAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
pars2-201 Contained in:
[BAC] DKEY-218B7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000024446 (1),  Ensembl_Trans:ENSDART00000065211 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC065673 (1) 1719 nt
GenBank:BQ263682 (1) 691 nt
GenBank:BM957292 (1) 662 nt
GenBank:CO355509 (1) 600 nt
GenBank:CK699187 (1) 506 nt
GenBank:CO355127 (1) 430 nt
CITATIONS (2)