ZFIN ID: ZDB-TSCRIPT-090929-7251
Transcript Name: ttpa-202
Previous Name: ttpa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024383 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024383|OTTDARG00000019744|ZDB-GENE-030131-4631 ttpa|OTTDARP00000020137 ttpa-001 LG_ BX248497.11 Danio rerio protein_coding KNOWN, 1837 bp
TTTCCTGCCCCTTTTTACGTAAGACTGGACTGCCGCTCTG
AGAACAACATGACACTGGACCGCCCGTCGCAGATATGAAG
TCCGAAGAAGTAGACGAGACTGAAGAATTAAACAATTTAC
CTGTTGATTCCTCCCGGATTGCACCATATTTGTCAGAGTT
GAAAGAAAAAGCAGAGGCAGAATTGCGCATTCGAGACTTG
GACTTGTCGAAAACTTTTTTGATACGGTTTTTGCAGGCGA
GAGACTTTGATGTGGCGCTGGCGCTCAAGCTGTTGATTAA
CTATCATAAATGGAGACAAGAATGTCCAGAAATAACAGCC
GATCTGCGTCCCTCATCCGTCATTGGACTTCTCCAAAACA
ACTACCATGGAGTTTTGAGATCGAGAGATGATGCTGGAAG
TCGAGTTTTAATCTATCGGATTGGTAAATGGAACCCCAAA
GAGTTCACAGCCTATGAGGTTTTTCGTGTCAGCCTCATTA
CGTCAGAGCTGATAGTTCAAGAATGGGAGACGCAAAGAAA
TGGACTCAAAGCGATTTTTGATCTCCAAGATTGGTGTTTT
GCTCATGCTCTGCAAATAAATCCTTCTTTGGCAAAAAAGA
TATCCTCTGTTCTTACGGATTCCTTTCCATTGAAAGTGCG
TGGCATCCACTTGATAAACGAGCCAATTTTTTTCCGTCCT
GTCTTTGCTATGATCCGACCATTTCTTCCAGACAAAATCA
AACAACGGATTCATATGCATGGCTGTTCATATGCCCGAAG
TCTCTGCAATTACTTTCCAAAGGCAGTACTCCCTCCTGTG
TATGGAGGAACTGGACCCAGCGTAGATGAAGTGTGTCAAG
AGTGGACCGAGTACATCATGCAGTCTGAAGACTATCTGCA
CAGGCTCTCTGTTGACTTAGGTGGAGAAGGAGGACATGCT
TCTCAGTCATAAAGTGAAGGTGTGAACCATCACCTCATCA
TTTCAACATATGTTGAACATTTTTTTATTTGGGTTTTTTC
ATATTGGACATGACTGAATGGTGCAGCTTTTTTAAATTGT
CTGTGTGATTAGCTTTTAAGATATTCCAAACTGGAAGAAA
TAACATTCCTGTTTACTTAGTTTGACTGAGTATATATATT
TGGATAATAATGTGATGTATTGAAGCACTTGATTTGCTTC
TGAAGATGTGATCTAGCATCAGATATCAAATATCAGATGT
TTGTTACCTTTAGTATAAGGTTTCCACAGTCACTTGTAAA
TAGCAAAAGAACAATGTAATAATATTGTACATGACTGAAA
TAATAAGTGCCTTCTGATCTGTGATGGTGTTTATTGGCAT
ATTTTTATCAAACTGGACATAACTCAGGATGTTACAGGAG
TTAATCAAGGATTAACTGTTTGTTACACCTCAGCTGTTAA
AAATCAATGGATCTGTATTGTAACAATAAATTGCAGCTAT
TGGTAACCTTTGTTGTCTTTTCAGTCTACCAAGTGGGATT
GTAAAGTGGCACTTTGCTCTATTGCCTTCTGCTCCGATTC
TTAAACAAACAGACCAATGACCTTACTGGAGCTCTTCATG
TTTACATGGTTTCTATAAATGTGACTTTCTGAAACCCTGT
TTATAATGCTGTTTGTTCAATTTGTTGCACCCTTATGTCA
AAATATGTTTCACATGGCAGAAAAACTACTAAATAATCTA
CGCTAACATAATTGAATATAATCGTGTTGACTCGGTGTTA
TACTGTGAATAATTATCTCCTTTGTATTATACTTTATCAC
AATGATACAAATATATTCGCAGACACATTATTTCACAATG
TGCTAAACTTAATTAAAGCTGAAACTGGACACTTTCA

ttpa TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ttpa-202 1837
ncRNA ttpa-003 (1)    Ensembl 1045
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ttpa-202 Contained in:
[BAC] DKEY-181M9 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000024383 (1),  Ensembl_Trans:ENSDART00000145415 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CN328700 (1) 826 nt
GenBank:CN319025 (1) 812 nt
GenBank:DN768771 (1) 788 nt
GenBank:CT632192 (1) 725 nt
GenBank:CT584137 (1) 710 nt
GenBank:CD595598 (1) 650 nt
GenBank:CD601242 (1) 342 nt
CITATIONS (2)