Transcript

fkbp11-002

ID
ZDB-TSCRIPT-090929-7204
Name
fkbp11-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024336 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024336|OTTDARG00000019723|ZDB-GENE-030616-357 fkbp11|no_translation fkbp11-002 LG_ AL953886.9 Danio rerio protein_coding KNOWN, 593 bp
CGGTGACGGAAGTGAGTTTAGCTTTTATCCTGTCTGTGGT
TTCTCTTACAGCTGCTTTTTCTCTTAACGTGAGACACGAT
GGCAACTCGGACGGGGATCGTCTTGATTTTCCTCGCGGTT
TTTGCATTTGTTGCCGCTGAGGACGGGGAGAGCAAAGAAA
GCGTGATCGAACAGTTGGTTGTGGAGACGTTGGTGATGCC
GGAGTCGTGCACGATTACATCCGAGATGGGAGACACGCTG
CAAATCCACTACACGGGTCGATTAATGGACGGGAAGGTGA
TAGACACGTCTCTGTCTCGCGAGCCTTTGGTTGTAGAATT
GGGCAAGAGGTCTGTCATCACAGCCTGGCACAAACAGCTC
TGCTTGTCCTGGGTATGATGAAGGCCCGCCTTTAGAAAAA
ACAAAATGTGTTGTGATTGGTTAGCTGTCCTATTGCATTG
TGATTGGTGAGCATCTTAGACGGAAGCAGCCTGCAAAACC
TCACTTGAAGGTGGCGTATCAACAGCTCCAGCTGGTGCGA
TACTAGACAACCGCTCCGATCTGTGGGCATCTATGCTCTA
GTGTAAAAGTTAAGTTATACACTCTTGCTCCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations