Transcript

fkbp11-201

ID
ZDB-TSCRIPT-090929-7203
Name
fkbp11-201
Previous Names
  • fkbp11-001
  • ottdart00000024335
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024335 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024335|OTTDARG00000019723|ZDB-GENE-030616-357 fkbp11|OTTDARP00000020111 fkbp11-001 LG_ AL953886.9 Danio rerio protein_coding KNOWN, 1312 bp
GCAGAAGCGAGACTCCGGTGACGGAAGTGAGTTTAGCTTT
TATCCTGTCTGTGGTTTCTCTTACAGCTGCTTTTTCTCTT
AACGTGAGACACGATGGCAACTCGGACGGGGATCGTCTTG
ATTTTCCTCGCGGTTTTTGCATTTGTTGCCGCTGAGGACG
GGGAGAGCAAAGAAAGCGTGATCGAACAGTTGGTTGTGGA
GACGTTGGTGATGCCGGAGTCGTGCACGATTACATCCGAG
ATGGGAGACACGCTGCAAATCCACTACACGGGTCGATTAA
TGGACGGGAAGGTGATAGACACGTCTCTGTCTCGCGAGCC
TTTGGTTGTAGAATTGGGCAAGAGGTCTGTCATCACAGGC
CTGGAGCAAGCCCTGGTTGGAGTGTGTGAAGGACAAAAAA
TCAAGGCCATGATTCCGGCTCATCTAGCGTATGGGAAAAG
AGGATACCCTCCAACCATTCCAGGTGACAGTACGCTGGAG
TTCGAGGTGGAGGTGATCTCTCTGTCCCAGCAGACGCCAT
GGCAGAAGCTCATCAATGACATCTTGCCTCTTCTGTGCCT
GGCGCTGGTTCCCACTTTACTGGGTTTAGTGGGACTCTAC
CTCTACAACAAAGCACACGCACAACCTCAAGGCAAGAAGA
AGAGCAAAGACAAGAAGAGCAAGAAGAAATGAGATCAAAG
CCAAACAGAATAAACTATTTAAATAAAAATATTTTTGGTG
CTTTCAATTTTTTTTTGTGACATTTGTGAGATATTACGAC
ATGTAAAAACTGGTATGTATTGAATTATTACACTAAAAGT
TTTTTTTTTGGACAAAAAATAGGTGGAGGGCAGGGATAAT
TGTGTTTTTTGTCAATAATTCAGATGATTTTTTTGCTTCA
TCTGAAAACATTCTACCTCTCACCTGTTTCAGTTCAATAT
ATACCATCCTTTAAAAGTTTGAGGTCTTTCCTGCGCCTCA
AGACTGCATTTATTTGATTAAAAAGAGTAGAAATGGAGTC
TTTTATTCCTGTGGGGCACGTTTTATGCACGACTCACGTG
ATGTCCAATTATTCTTCTGATATGTATATCGTAATTGGTG
ACTTAAGAGATTTAATATTATTATTATTATTAATATTAAA
TACAGTGCTGGTTAGGTGGTTCATTCCACCGTTGTGACCT
GATAAATAAGGGACTAAGTCAAAGGAAAATGAATGAACAG
TGCTGGTTAAATATTTGTGTGGAAACCCTAATGCATCTTT
TGTATAATTTAGGTAATATTATTTGCTTAGAATGTATAAA
AAAAATAAATACAATTATTTTTAACAAAATAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations