Transcript

sox21a-201

ID
ZDB-TSCRIPT-090929-7202
Name
sox21a-201
Previous Names
  • sox21a-001
  • ottdart00000024334
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000024334 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024334|OTTDARG00000019722|ZDB-GENE-990715-6 sox21a|OTTDARP00000020110 sox21a-001 LG_ AL953886.9 Danio rerio protein_coding KNOWN, 1129 bp
TTGATTCAAAACTCGAGCGCAGGCGGCACAAATCCGAGCA
GTGATGAGCATTTAAAGCCAGGTCACTTCACAAACTCTGA
AGCACTCCGCGCGTGCATGGATGACAACTCCAGCTATCGG
GACTGCGTTAAGAGACCACTGTCTGATGGCATTTTAGTAA
GACATTTACAGTGAAACTTATTTTTAGACGCAGGCTCAGA
TTTGGATGCCATGTTACAAAGGTAACAGGGCCAGGTCTGA
CTGAGCAGGGCGTCAAAGGAACTGTTGGACTGAACTGAAA
AAGGAGCACCAAAGTATCAAGAAATGGCAAAGCCCATGGA
TCATGTTAAGCGCCCCATGAACGCTTTTATGGTGTGGTCG
AGAGTTCAGAGGCGGAAGATGGCTCTGGACAACCCGAAGA
TGCACAACTCGGAGATCAGCAAGCGCCTCGGAGGCGAATG
GAAACTCCTGTCAGACTCTGAGAAAAGACCTTTCATTGAC
GAGGCCAAACGACTCCGAGCCGTCCACATGAAGGAGCACC
CGGATTACAAATACAGACCGCGGCGAAAGCCCAAAAACTT
GATCAAAAAAGACAGGTATCATTTTAATGTCACGTATAAT
CTGGGTGAGGGGGACCCGCTGAAGAGCGCGCGCCTGTCCG
GGGACGCGCTCTCGGACTCTTTGAGCGCGGAGAAAACGTC
TGTCGCCGCCGCTGCTACTCGGGTGTTTTTCAGCCACCAT
CTGTCCGCAAACCCCTATCCTTTTCTCGACCTGAACTCTA
AAATATCGGAATTACCTCCTGCACCTTTCCCGCATTATTC
CGTGCTCGGGTATCCCAGCGGACTCCCCGCGTTTCCCGGG
ATGGGGGTTCTGGCCGGTGCGCCCCACGCTCACCCGTCTG
CGGGGAGTCCAGGTCACATGCTGCCCTATAACTGCCTGGG
CTGGCCGGGCTCTGGACCTGCCGTTCCCTCATCTTATGTA
CTTTTACCAGGAATGACCAAAGCTCAGCATGAACCTTACC
TGGCATATGCTGCAACGATATGAGTGGAGTTTAAAGGGCC
ACGCTGTTCATGTGGTACAAGGTCACGTGCACTTGTTTGA
AGTTTTGCATTTGTCAAAAAGAAATAAATGTGTAAAATAT
TTGTGGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations