ZFIN ID: ZDB-TSCRIPT-090929-7162
Transcript Name: ndufa9a-002
Previous Name: ndufa9-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024294 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024294|OTTDARG00000019702|ZDB-GENE-050320-20 ndufa9a|no_translation ndufa9-002 LG_none BX004976.7,CR396584.16 Danio rerio protein_coding KNOWN, 268 bp
CAGGACCCTGAAGCTAATGGGAAAACCTATGCACTAGTTG
GGCCCAATCGGTATCTACTTCATGATTTGGTTGAATATTT
ATACTCCGTGGCCCACAGGCCATTTATGCCATACCCTTTG
CCTCGCCCTCTCTATCACCTCGTCGCAAGGTTTTTTGAGA
TGAACCCTTTCGAGCCCTGGACAACCCGTGATAAAGTCGA
CCGGGTATGTGTATATTACAATGTCATAACAGATTAAGTG
CACTGTTCATTAATATTTGGCATAATTA

ndufa9a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ndufa9a-001 (1) 1697
ncRNA ndufa9a-002 268
ndufa9a-003 (1) 402
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ndufa9a-002 Contained in:
OTHER ndufa9a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024294 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AI106047 (1) 268bp
    CITATIONS (1)