ZFIN ID: ZDB-TSCRIPT-090929-7161
Transcript Name: ndufa9a-001
Previous Name: ndufa9-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000024293 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000024293|OTTDARG00000019702|ZDB-GENE-050320-20 ndufa9a|OTTDARP00000020085 ndufa9-001 LG_none BX004976.7,CR396584.16 Danio rerio protein_coding KNOWN, 1697 bp
GTGGCGACCCCAGATTAATAAAGGGACTAAGCCGACAAGA
AAATGAATGAATGTTTACCTCTGGGGTTAAAAAAAAACTG
AAGTTCGTACAACTGTGGGAATAACCATTTATAGCGTCGT
AAACGTTCGGTTTTTCCTTTACAGTGTACTTGTAACTAAA
TTGTGTTTTGTTGGCTCACAAATAAACGACAAATCTGTAA
AAACTAAAACGCTTAACAAGCTCTTACCGTACCATCCATA
GAAAGTCAAATTTCGCGGTTTTTGCTTTGCGTTTGAGCCT
CCTCAGCTTCCGTCTCAGCTCTGACGGCCATAATCATGGC
GGCTGTCACACTGATTTGCCGTCCTGCGGGTGTCCTTCCC
AAGCTTTCAGGCACCTGTTCTCCGGTGTTGCTGGCAGCAG
CTCCTGTGACGGTACAGCAGAGGAAGATCCATCATGCCGT
AGTGCCCCGTGGAAAAGGAGGCCGCTCATCCATTAGTGGA
CTCGCTGCCACTGTTTTTGGAGCCACTGGCTTTCTTGGCC
GATATGTTGTCAACCGTCTAGGACGTATGGGTTCCCAGGT
TGTGATCCCTTACCGATGTGACCAGTATGATCTCATGTAC
CTCAGACCTATGGGCGATTTGGGACAGATCATCTTTATGG
AATGGGATCCAAGAAACAAGGAGTCAATCCAAAGAGCAAT
CTCTCACTCCAACGTGGTGATCAACCTTGTCGGAAGAGAA
TGGGAGACCAGCAACTACAAGTATGAGGATGTGTTCGTCT
CCATCCCTCTGCAGATTGCGAGGGCAACTCGTGAAGCTGG
AATTAAAAAGTTCATTCATATGTCGCACCTTAACGCAGAC
ATCCGCAGCCCCTCCAAGTATCTGAGAAATAAGGCAGTCG
GTGAGGAGGCGGTGAGAAACGAGTTCCCTGATGCCATCAT
TATGAAACCCTCTGAGCTCTTTGGAAGAGAGGACAGGTTC
TTGAACCACTTTGCTAACATGCGCTGGTTTGGCACAGCTG
TACCTCTAATTGCAATGGGCAAGAAGACAGTCAAGCAGCC
TGTTCATGTGGTAGATGTGGCCAAAGCCATCATTAATGCT
ATCCAGGACCCTGAAGCTAATGGGAAAACCTATGCACTAG
TTGGGCCCAATCGGTATCTACTTCATGATTTGGTTGAATA
TTTATACTCCGTGGCCCACAGGCCATTTATGCCATACCCT
TTGCCTCGCCCTCTCTATCACCTCGTCGCAAGGTTTTTTG
AGATGAACCCTTTCGAGCCCTGGACAACCCGTGATAAAGT
CGACCGGTTGCACACATCGGACTTGAAGTACCCTGACCTC
CCGGGACTGGAGGATTTGGGCATCACACCTGCTTCCATCG
AGCAGAAGGCCATTGAAACCTTGCGCCGCCATCGCCGTCA
ACGATTCTTTGAAGCAGCGGTTGGAGAGGCCAAGCCCTCC
AAAACAGTCAACTTTTAAACAAGAAGTGGTCGCTCTTGTG
TCCAGTATGTTCTCTACTGGTCCTCACGTTGTCTAGATTA
ACTTTTTGCTGTACATAAATAAAGATATTCAACCTGTACT
TTTGCTGTATGTGTTTTTTTCCCTGGCTGAGTTTATTTGT
TTGGGTTTTTGAAGAGAATTTTAAAAGAAATCTAATGAAT
TGCACCAATTGAATCTAAATATTCAGTGTTTTGTGTGTGT
GTGTGTGTGTGTGTGTG

ndufa9a TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ndufa9a-001 1697
ncRNA ndufa9a-002 (1) 268
ndufa9a-003 (1) 402
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ndufa9a-001 Contained in:
OTHER ndufa9a-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000024293 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC153422 (1) 1715bp
    GenBank:BC068378 (1) 1299bp
    GenBank:BC091545 (1) 1265bp
    GenBank:CN506991 (1) 890bp
    GenBank:CT729176 (1) 785bp
    GenBank:DV589315 (1) 770bp
    GenBank:CT616744 (1) 719bp
    GenBank:AI957978 (1) 582bp
    GenBank:BG308717 (1) 537bp
    CITATIONS (1)