Transcript

atxn2l-201

ID
ZDB-TSCRIPT-090929-7142
Name
atxn2l-201
Previous Names
  • atxn2l-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024266 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024266|OTTDARG00000019689|ZDB-GENE-030131-3246 atxn2l|OTTDARP00000020067 atxn2l-001 LG_ BX784026.17 Danio rerio protein_coding KNOWN, 3681 bp
CGCGTTCATCGCTGGCTAATTCGCGAGACGTGGTGCCGGT
AATATTTAATAGAAAAAATAAGGCTTGTTGCCTTTTCGTG
TTGCGTTCGCGACGGAATATCGGACCGAACTGGACTTCGC
GCTTTAACGGAGATCGCGCTCGTGCGGACCTGAAATCGCC
GCGGAAAAACTACAAAAATAACACCGCAGGCAGGCTAGTC
CACATACTAGCTTGTCATAGGCAACAAGGGGAATTTAGCG
GGCAACTCAGTTAGCGGCTAGTTATGTCTTTTCGCCGACA
GAACCAACCTGGACCCGGTGGCCGCAAAACATCCAATGGA
ACTTCAGGGTCAATGGCTTCATCCGTTCCGGGGAGCAACT
CTAACAGACCCAACCCGGGGAGAAACAGAAACTCCGTGAA
GACTCCTTCACAGTCACCACCTGTGTTTGAAGGTGTGTAC
AACAACTCCCGGATGCTCCATTTTCTCACAGCCGTCGTGG
GCTCCAGATGCGATGTTATGGTGAAGAACGGCAGCTTGTA
TGAGGGAATCTTTAAGACGTTAAGCTCACGTTGTGAGCTG
GCAGTGGATGCTGTGCACAAGGTGAAGAATGAGGAAGGAG
ATGGAGGCGGTGGAGGCGGCACAGCTGTCCATCCCAGGAA
AGAAGAGATCACAGACACCATGATCTTTGGCCCTAGTGAC
CTTGTCACTATGATCTGCAGAGACGTAGACCTCAACTACG
CTACCCGAGACACTTTCACAGACTCTGCAATTGGCTCATC
AAGATTAAACGGTGACCACAGAGAGAAGGTCCTCCAGAGG
TGGGATGGAGGCGACAGCAATGGAGAGAACTTTGACTTAG
ATGCAGACACAGCTAATGGTTGGGATGCCAGTGAGATGTT
CCGCTTTAATGAGGAGACCTATGGGGTGAAGTCCACCTAT
GACTCCAGTCTCTCCATGTACACGGTTCCTCTGGAGCGGG
GAAGCTCTGAGGGCTTCAGGCAGCGAGAAGCTCGAGCCGC
CCGATTGGCCAATGAGATCGAGGCTAGTTCACAGTATCGC
CACAGAGTGGCACTGGAGAATGATGAGGGAAGAACTGATG
AAGACAAATTCAGTGCAGTGGTTCGAGACCGGGAGCGTGA
AGCAGCAGAAAGAGAAAGGGGAAGAGACAGCCCTGGGTTC
TCCAGTGCTGGGAGCAGGGAGGGCAAATACATTCCTCCCC
AGAGAGCAAGGGAGCGAGAGATGGGAGTTTCTGGCAGGGG
TGAAAGAGGTGGGGCTGTGTCCACCCTGCCTAATCGAACA
AATCGACCCGGACCATCAAGCTCCTCCCCTAGACCCCTCC
CCTCTGCTAACAGCCAGGCCCTTCCTCCCACTGATAGGAA
CAGCTCTCTGTCAGTCAGAGGAGGATTCTCTACACACCAA
TCACAGAGCAGCACACCAACACAGTCCCGGCCCTCAGAGC
CGGGTCACTCCAGCCCTCCTTCCCCCCACACACTCTCACA
TTCACTCTCACACCCTCAGTCCCTCTCAGATGTGGCCCGG
CCTGTCAATGGAGTTTCACCCAAGTCTCAAAGGACTGGAC
AGACTAACAGAAACATGCGTACCTCAAACTCCCACTCCTC
CCCTACAGTCTCTCGCTCCCCTAAGCCAGATGCTCCTCCT
CAGGACCCTCTTCTGACTGGATCTTATTTGGACCCCTCAT
CCAAACCTGTTGGCCCCACTCCTCTGTTCCCTGTAGATGT
AAATGAGATCCTGTCGAAGGAAAGGATGGAGAGTCCAGTT
GGTCCACAGGAGGGCAAGAGCAACAAAATACCTTCGGTCC
AGCAGAGATCACAAATCTCTGAGGAGCTTCGCAAGTTTGG
TAATACTTTTAGGCTTCAGCAAAACCCCAAAACTTTGCCC
ACTGAATCTACTCAAGCAAACCCTGCCCACAACACACAGA
CTGACCCCGCCGCTCCCACAGAAGCAAAACCAGCCCCGCC
CACAACCCCGAACACAGAGCTTTCAGCAGAGGAGCGAAGT
AGAGAGACTAATCCAGAAGGGCCGGTGACCTCCACCCCTC
CACCGGCCACATCCATCTCTGCACCGTCTGGGATTGGCAT
GCAAAATCCACCTGCAGAAGGGCAGACGGCGGGGGCGCCC
CAACCTGCAAGGACCCCAGGCAGTGAGGATGGCAAACCAG
AGGCCCCTGAGAGATCTGAGGGCATGACCGATCAGGTGAA
GAAATCCACACTCAATCCCAACGCCAAAGAATTCAACCCC
ACCAAGGCTCCTCTTAGCATGGTGAAGCCCTCGGCGACTC
CCACACCACCACGACCAACCCCACCCAGTCCTACAGTCGT
GCTGCAGACCCAACCAGGCCAGGGAGCCGTTTATAACCCC
CAGTACCTGAGCTACGTCTCCCAGGTACCCATCCAGATTC
AAGGCCACTCTGTGCAGCCTCAGATCCCATATTCGTATAT
GACCGCTGTTAGTCAAGGGAAGTACCCAAGAACAAAAGGT
TCTGTGGTAACTCCTCGTCCAGACCACAGCTCTTCAGCGC
CCCCTATGATCCAGGCTGCATCAGCAGCAGGACCTCCTCT
AGTGGCGTCTCCTTACCCTCCCTCTTATCTACAGTACAAC
CAGGTCATCCCAGCAATGCCCCACTACCCTGGACACCAAG
TATACTCAATGCTCCAGGGTGGACCACGGATGCTTGGATC
TGGAGGACACCCACAGGCTCTGGGACCTCCAGGCCCTCAG
TACCCAGGTCAGACTGAAGGGCCATCAGCTCCTCAACAGG
GGATGTATGCTCCGCAGTCATTCTCTCATCACTCGGGCTC
CATTCATCCTCAGCCCTCCAGCACCCCTACAGGCAGCCAG
CCGCCCCCTCAACACCCCGCTCCCAGCCCGGGACAGTCTG
GTCAGTCTGGTCCTCAGCCTCAGTCTTTGTATCACTCTGG
GCCGCTGTCAGCCCCGACCCCTCCTAACCTTCCTCCAGGA
CACAGCTCTCCACAGGCCTCTTACTCCCTTCAGGGCTACA
GTCTGCCGGGACACCAGCCACTGCCGCATCCTTACTCCTC
TCTGGGACAGCTCACACAGGCTCATGTTCCCGGTGCTCTG
TCGGGTCCACATCACACAGGAGGCCACGGTCCTCCGCCAG
TGATGCTGCTTCATGCTGCCCCTCAGCAGGGTTCTGGCCC
TCAACACGGCCCGCCACCACAGCAGGGGGCCCACCAGCAC
TTCACCTACCTAGGACCTCAGGTGCCAGTGCAGGCTCACA
ATCCCCAGCAGATTCCATATCACCCTTCTGGAAACTGACA
GACAGACTGAGAGGGAGAGAAAGAGAGAGCGCCCCCATCT
GGACCTTCTGTGTGACCGCATATGTACATAATCTCCATCT
GCTTCACCAACGAGGACAAAAAGATTTCGCTTTTACCTCT
GGCAAGACTGAATGTTCTGGTTTTATTTAGGGTTTTTTTT
TTTCTTCGTAATTTTTAATTTGAGTGGACGGAGACACGCA
GTGTCTAAAAGCAGAACGACGAAACGAGTGAGTGTGCAAG
ACAAAACAAAAATGGAAAGAATGAGGGACATTTTTATAAA
AAATACAGTGACCTCTCCCTTTGTCCTCAAACCCCCCTTA
TTAAATAAGCAAATAATAAATGGTTAAAAAAAGAACAAAA
AAAATAAAAAAAATGTATAAAAAATAAATTTTTAAACTCT
C

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations