Transcript

rpl19-002

ID
ZDB-TSCRIPT-090929-7138
Name
rpl19-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024260 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024260|OTTDARG00000019685|ZDB-GENE-040426-2290 rpl19|no_translation rpl19-002 LG_ CR388097.9 Danio rerio protein_coding KNOWN, 799 bp
CTCATTGACAGCGGCTGCTGCTTTCCGCTGACCACCAGCC
ATGAGTATGCTCAGACTTCAGAAGAGGCTGGCCTCCAGCG
TCTTGCGCTGTGGCAAGAAGAAAGTGTGGCTGGACCCAAA
CGAAACCAACGAAATTGCCAATGCAAACTCCCGCCAACAA
ATTCGTAAGTTGGTGAAGGATGGTTTGATCATCAAGAAGC
CCGTCACGGTTCACTCCCGTGCTCGATGCCGCAAGAATAC
TCTTGCACGAAGGAAGGGTCGTCACATGGGCGTTGGTAAG
AGAAAGGGTACCGCAAACGCACGTATGCCCGAGAAGTTGT
GCTGGATGAGACGCATGCGTATCCTGCGTCGACTTCTGAG
ACGTTACAGAGAGGCCAAGAAGATCGACAGGCACATGTGA
GCCCATGTTTAATGCTCATTTTAATTCCACAGATTGTAAC
CCAGATGTTTGTACTTCATAAAATATTGTGCAATAAGTTG
CTGGTGTTTTAGTCTAACTACATTTTTGTGATCTCTCTCT
CTCTCTCTCTCTCTTTTTATTTTTTTTTAAATTTATTATT
ATTATTTTTTATTTCATAAATGTAGCATACACAAGGATAG
GCACCTAATGCAGGGATCCACAAATAAAAATGTCTGTTTT
TTTCCCCAGGTACCACAGCCTGTATCTGAGGGCAAAGGGT
AACGTGTTCAAGAACAAGCGCATCCTGATGGAGCACATAC
ACAAGCTCAAAGCAGACAAGGCCCGCAAGAAGCTCTTGGC
TGATCAGGCTGAAGCTCGTCGTACAAAGACCCGTGAGGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations