Transcript

rpl19-201

ID
ZDB-TSCRIPT-090929-7137
Name
rpl19-201
Previous Names
  • rpl19-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024259 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024259|OTTDARG00000019685|ZDB-GENE-040426-2290 rpl19|OTTDARP00000020063 rpl19-001 LG_ CR388097.9 Danio rerio protein_coding KNOWN, 722 bp
CAGTCCTGAAATCTTCCTCATTGACAGCGGCTGCTGCTTT
CCGCTGACCACCAGCCATGAGTATGCTCAGACTTCAGAAG
AGGCTGGCCTCCAGCGTCTTGCGCTGTGGCAAGAAGAAAG
TGTGGCTGGACCCAAACGAAACCAACGAAATTGCCAATGC
AAACTCCCGCCAACAAATTCGTAAGTTGGTGAAGGATGGT
TTGATCATCAAGAAGCCCGTCACGGTTCACTCCCGTGCTC
GATGCCGCAAGAATACTCTTGCACGAAGGAAGGGTCGTCA
CATGGGCGTTGGTAAGAGAAAGGGTACCGCAAACGCACGT
ATGCCCGAGAAGTTGTGCTGGATGAGACGCATGCGTATCC
TGCGTCGACTTCTGAGACGTTACAGAGAGGCCAAGAAGAT
CGACAGGCACATGTACCACAGCCTGTATCTGAGGGCAAAG
GGTAACGTGTTCAAGAACAAGCGCATCCTGATGGAGCACA
TACACAAGCTCAAAGCAGACAAGGCCCGCAAGAAGCTCTT
GGCTGATCAGGCTGAAGCTCGTCGTACAAAGACCCGTGAG
GCCCGTAAGCGTCGCGAGGAGAGACAGCAGGCTAAGAAAG
AGGAGATCATTAAAACTCTTTCCAAAGAGGATGAGACCAA
GAAATAAGTTTGTCTTTCTGCTGTCCCCTATGTGTTGTTT
AATTCACTTAAGTGATGAAAATAAACACTGTTTGTTACAG
CT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations