Transcript

xirp1-201

ID
ZDB-TSCRIPT-090929-7091
Name
xirp1-201
Previous Names
  • xirp1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024208 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024208|OTTDARG00000019651|ZDB-GENE-050221-2 xirp1|OTTDARP00000020025 xirp1-001 LG_ BX649335.8 Danio rerio protein_coding KNOWN, 7297 bp
CCTGAATAGGTGTGCAGTGAACTAACTCAACTATCCCCAG
CTAAACACGGAAAAAGGTAAAGTATTTCAGCTTAATCATA
CTAACATTTTAACAATGTTTCAATTTATTAAATCATTGCA
TTGTGGAGAGTAACGTGAGCCTTCATACTTCTTTGCCCCC
AAGATGGCAGAAGTAGCCAAACAGAAAAAAGCTACAGAAG
CAGTCTGTGGAGATGAGGATTTCCCTCCACCTCCACCTCC
TCTTCCAAGACCTCAGGTTCTGGAGTCACTTCAAAAAGAT
CTAAGCCAGAACTTCCTCCCCGTACCACCTCCAAAAGAAA
CCTTCTCAGAGATCTACCAACAACGACAAAAAAGTGAACT
GAAGCGCCTTTTTAAACACATCCACCCTGAACTGAAGATG
ACTGTTGATGACGTTGTAGATGACGAACTAATTGATGCAA
TAAATCCTCAAGCAGCAGATGCAGCATATCAGGGAGAAGT
CCAATCCATGCGGTGGATCTTTGAGAACTGGACTCTTGAT
AATATTGGAGACCCACATGAAACTAAAAAACTACTCTGTG
AGGAAAATCCTCAAGGTGGGGATGTGAAGGGCAAATCCTC
TTTGTTTGAGCATTCAACATTCGACAGTCAGCATGCAGCA
GGTGCCGAGAGAGCAGGTGTAGTCAGAGGAGATGTTCGCA
CAGCCACCTGGTTGTTTGAAACACAGCCTCTAGATTCAAT
CAGCAAGTCAAAGATAGAGGATGAGGAAATTGTGGAGGTC
GTCTTGAAGGAACCTGTTCAGAAGGGTGATGTGACCGGCG
CACGTCGTCTGTTTGAAACCAAACCACTGGATTCTTTAGG
TCGCTGCTGCTCTGTCGAAGACCAACATTTCCTAACATTA
AAATCAGAACTCCAAGAGAACAAAGGAGATGTGAAGAAAA
CAGTCAAACTTTTTCAAGCAGATCCCTGTTGTGCGCTTAG
GGATAGCAATGGTAAAATCCATGAAATCAAATCAATCTGC
AGAGAAGAAATCATGAGCAGTGACTTTAAAACTGCACGTT
GGCTTTTTGAAACTCAACCCTTAGATCACATTAATGAAGG
AGCTCATGTTCAGATAATTCGAGGGATATCTCTTGAAGAA
GCTCAGAGAGGCGGTGTTGATAAGAAAAAGTGGATGTTTG
AGACGCAGCCGCTTGATGCAATTCACGAAGGTGTTGTGGA
AGAGCAAAAGTTTCAAGGAACAGCAGTGGAGGGTTTCTCT
GGAGCAGCAGATGTTCATAACAAACTACAGCTGTTTGAAA
ACCAGCCCCTGTCATCCCTTAAAGGAGATTCTGAGGGTGA
CGTTTTAGAGAAGGAGGCAATTGTTGGAGGAAATGTTGGA
TCCACCCTATGGCTTTTTGAGACTCAGCCCATGGACACTC
TGAAAGATAGCTACGAGGTGGGACGTCTCCAGAAGGTTAT
GGTATCAAGTGATGAAAAAGGAGAAGTTCAAGACAAAAGG
ATGCAGTTTGAGAAGTCCACTGCTGGTAAAACAGCAGGTG
ACAGTGGAAACAAAGTTCAAAATGATGAGAAAGGAGATGT
GAAAACTTTCAAAAGCCTTTTTGAGACATTACCTCTTAAT
GTTTCCGAGAAAGCACAAAGTCAAATTCATGACATTACAT
CTGGGGATGTCAAAGGCCACTGCTCACTGTTCGAAACAAC
ACCACTGTATGCGATTAAAGACTGTGCTGGAAAATTCCAC
GAAGTTACCACTGTCAGTAGAGAAGAATGCATTAAAGGCA
ATGTACAGAATTACAAATGGATGTTTGAGACGAGACCCTT
AGACCAATTTGAAGAAGGTAGCGGAAAAGTAGAACTCATC
AAGGGCATTACAAGGCAAGAAGACATGACAGATGACACGA
GGACAGCCAAATGGATGTTTGAAACACAGCCTTTGGATTG
CATGAGTTTAAATAGTAGGACAGATGTAGACTCGACACAG
AAAGAATTTAAAAAGAGTAATGTGAAAACATGCAAATGGC
TGTTTGAGACAAAACCAATGGACATGTTGTATGAAAAATC
AGAAGGGAAGCAGGATGTAGAACCAGTACCGAAAGCTGAT
GTGAAGTCACACACTTGGCTTTTTGAAACACAACCACTGG
ATAACATTAAAGACAAGGAGAACCTTGGTTTGAAACTGTG
CAGCACTGTGCAGGAAGACGTAAAGAGTGATGTGAATGTG
AAGACAGTGAAACACCTGTTTGAAACTGAGCCTTTAGACA
GAATCACAGATCAAGCCGATTCTGGCCAAAACGTAAGGTG
TGTCAGCCAGGTGGATATGCAGTCTGGAGATGTTTCACGT
GTCAAGGAAATCTTTGAATCTAAATCGCTAGGAACTGAGT
CTTCCAAATGGTCTGAGGAGCAGAAAAATGAAATTCAGTC
AGGATCTGTCCACAAATTCACTTGGTTATTTGAGAATCAG
CCTATTGGTGACATTAACGAGAAAGAGGAGAGAATAGTGT
CATGCGATGTTGAGGCTGGGGATGTTGGAGGCAAGAAGTT
TATTTTTGAAACCCTCTCTCTGGATAAGATTAAAGACAAA
GATGAACTACTTGAGCATCCGTCAATGATTATAGAGAAGC
CTTTGAGCAGTAGTGTTAATGTGAAATCCAACACAATGCT
TTTTGAATCCCAGCCATTGTATGCTATAAGAGACAAGGAT
GGGCAGTTTCATGAAGTTACCACTGTAATGAAGGAGGAAG
TCATGAGAGGAGATGTCAGGGGTGCAAGATGGATGTTTGA
AACCAAGCCACTGGATACTATTCAAGCAGACAAGGAAATC
TACGTCATCCGTGCAGTTACGCAGGAGGACGTGCACAAAG
GAGATGTGAAATCTGCGCGATGGAAGTTTGAGACTCAGCC
TCTTGACTCATTTACACCTCACGAAGGGCCCTCTGTGCGT
GTTGTTGAAGATATAGGCAATGAAAAGTGTGTGCAACAAA
GCAGGCAGCTTTTTGAGACAGAGCAAGCATCCCAAAAGAA
GTTTGTGCGAATGGTGAGCGTTACAGATGTTCAACAAGGT
GATGTACGTACCTCAACCTGGCTTTTTGAGAATCAGCCTA
TTGATACTCTAAAAGGTGAACCAGATGAGCAGAACAACTT
GACAGCTGTACATAGAGAAGATAACACTAAGGGAGATGTG
AAACGCTGCACTTGGTTGTTTGAATCACAGTCCTTAGATA
AAATAAAGGACAATAAGCCAACTGAAGAGTTGGTTTCATC
AAGGGAAGAAATTCCCAAAGCTGATGTCAAAAGTACAACC
TGGTTATTTGAGACCACACCACTTGACAAAATCACTGTTG
AAAGTGTGACAGACATACTATACAGACTTTGTCATAATTC
CTTCATTCATTCCAGCGGAATCATCATCCAAGCAAATGAT
TACAAGTATGTAAACATGGCAAAATATCAGATTATGAAGG
ATGAGGGGCCCAAAGTCCTAAAGGAAGAAGTTGTTGAAGG
AAACATCAGGAACCTAATGTTGCAGTTACTGTTCAAACCC
AATATTAAACCTATGGTTGTCCTCCTTAAAGAAGACGAAC
AAGGCAAGATGCACAGTACAGTACTTGAAATCCCATTTCA
ACAGCCAGGATCTGCAACCAACCCTGAGGCGGAATGCAAG
ACCCAAGAAGCAGTTAAAATTATTGAGAACTTGCTGGTTC
AACAAAAGGAAATCAAGACAGGTTTGGTCATGCAAGAATC
TGAAGGTGGGCAGCCAGAAATGACAGTATATTCCCTTCAC
TGTGAAAGCAGCTTAACTGAGTCGCAAACCATCACGCGAG
GAGACGTCAAGTCCACCATTGGCAACCTCCTTGCCACAGT
CCACAGCCAGCAGACTAAGCAGTCTTGCAGAATGGAAGAA
ATCGAGAGGGGGAATGTTAATTTGTATAAAAGCTGCATTG
AAAAAGGCGACCTTAAGAGTCTACAGCGAGAACTTTCTGA
AGAAGATTTGGTCACGTCTTGTAGAGACCAAATCGAAATT
GTTCAAGGTGATGTAAAGGAAGCGATGCGACACCTAAGTC
AACAAAGAGAACAAGTTGAAAGAACAATCTTGGATGTTGT
ACCAGGAGATGTGAAAAATGTCAAAAAGGTTTTCTCTGAT
GTCTGCACAGACCTGAGCATTGGAAACTGTGTGCCAAGAG
AGGAGATAGTCCGAGGTGACATTTTGTCAGCCAAACAGCA
ACTTGGTGAGGCAGTTAAACAGCAAGTCATGGTCCAGAAG
GAGGAAATTGTTTCTGGAGACATTAAGGCAACACTTGAAT
CCTTGGAGCGAGCTAAACAACAAAGCATGCAGGTGGAGCG
TGAAGTCATAAAACCAGGCACCATTTATGATCTGAATGTA
GAGGCAGAAGAAATGTGCTCAGAAGAAAATGAAAGTAAAT
TAGTTAAAGAGGAAATCATTCCTGGGGATATTAAGGCTGC
CAAAAGATCCCTTGAGAGGGCAAAGAATCAAAGCATGAAG
GTAGAACGAGAACCAATCACACCTGGAAAGCTATATAACC
TGAATGAAACATCTCAGTGCCAAAGCAGCACAACAGTGGA
GCAGTCTACAACATCCACCTACAGTAACCACCGGATTACT
ACAACATTTCGAAAGGTTAGTGACATAGAAAAGGATCAGG
AATCCATAAAAAGATTGTGTTGTCTGAATGAAGTGGGAGG
GGGAGGAAAAAATATATATATTAACACAGAAGATGCCTTA
AGAATGGTAGATATTTCAGAGTCAGTACCAGATGTTGTTA
AAGGTGATGTAAAGGCTACTATTCAATCTTTAAGAAGTGC
TTCAACAGAGCAGAGAAGTGTAGACAGAGAAGAGATTGTT
AGAGGTAATATGCAAGAGACACTCCAGTGTCTCAAAAAGT
CTAGCATTAATATTTCTAGAGGAGATTACAAAGCAGCAAT
GTTATATAAACAATCTGGACAGCCTTACACTCAAAGCAAA
ATTACAAATGACTCAGGGACTAAAGATTGCAAGCAGAGTT
TTGATCATATTCCTTCATCTCACACTCAATTGTCTTCTTC
GGTTTCAGTGACCAGAAGTGAGCATCCAACCAGCCTGGCA
CTGAATTCAGAATCTGTTAGCTCCAACGCAGACAATTCAA
AGAACTCTAGTGCTTTTACAGGAAAAGATGAACACCCACC
ACCCATCCTTCCGAAAACTGGTCATCAGGTTAAAGATCAG
AAACCAGTAATTCCACCAAAGCCACTGCACATCACTACTA
GCTCCCCACCACTATTTACAGAAACATCAAATATGTGTCC
AAACTCAACTGTGAGCATTAATGATACACAACAGACTCCA
GCAATACCTCTGAAAGTGACTCCCAGCAATAAAATGTTTA
CACATGAAACAGAAATTGCAAAAACTTCAAACAAAATTAA
AGACAAGGAATCCAAAATTCATGAACAAGTTCAAAGGACA
AACTTAACTGATCCTACGGATTTTCAGAGGATGCAGTACA
CTGAACAATGGGTCCAGAATTCCCACATGCAAATTACAGA
CACTCCATCAGTCAATAAAACAGATTCTTTTAAAAATGGT
TCCTTTCCTGGTGATTCAATTGGAATGGAGAAAAATGTGG
TTCAGAGAATAAATGCTGCAGAAGAGATCAGGATGTGTTA
TTCAAAGGATAATGATGAACTAAACAAGGGTTTTAAGGCT
GTACTTCAGAATTTTGGAGAAAAGAAGACAACTACAGACA
CAGGCTCACCTTTCCCGAAGAAAATTAAAGTTGTGCAAAA
AGAAAACATTCAGGAACAGGCTAAAACCTCCAATAAAGAT
GAGTTACACTTCACCAGCAGAGACACCTCTTCAACACCTA
ACAAACATGAAGTTCCTTCAATTCACAATAATTCTGAGAA
CAAGGTAGTTTTGAGAGAAAAGAAAGCAAAGAGGGAGACA
GAAGATGAGCGCCGACAGAGGCTCTCCATCCACAGAGATG
AGATAATGAGGGGCAACGTAAAAGCAGCCATGGAGATCTT
TGAAAATCTTATGAGACGAGAAGAACTGAAGGTCATTTTG
TCAAAGGTTCAAGAAATAGAGGGGGAGACTTTTGAGGTGG
ATGTCAGATCTCTCAAGACTTTATTTGAAAATGTGCCTGC
TTGGATTACCAATCCAAAAGAAAATACCAAACGCAGACAT
CGTCCGAGAGTTGCCAAAGAGACGGAGGGCTTAAGAGATG
ATCTAGAGAGCATATCTTCAGTTGAGGCTGCATTTGAGGA
CCTAGAAAAAGCAAGTATGGACATTGTCAATTTGAAAGAA
CAGACATTAGCTAAACTCTTAGACATTGAGGAGGCCATAA
AAAAGGCTCTGTACTCTGTCTCAAATTTAAAATCTGAAGC
AGACATTGCAGGGTTGTCAGGCCTGTTTAGTGAATCACTG
AGTCCTGACAATGTCTCTCCAAGTACTAAAAACATAAGAA
AAATTAGCATTGTATCCAGCAAAACAAAGCCTGCTCAATC
CAATCAGATGCAGAGTGCTGATAACAGGGCTCTGTATAAA
GAAGTGCCACATGTACCTCAAGTTCAAGTGAGCAAGCAAT
CCTCAAACGTTCCCTCCTCACCTTCGTTTATTTCCATTCA
TTCTGCCGCAAGAAAACCAGCAGAGTCACCAACTGATAAA
CCTAAAACAAATGCAGACCAATCTAATGCAGGGAGCAGCT
CTTCCCAGAATAGCTCAGCCAGCCACATTTGTAGTCCTCC
AAGTCCAAGAAGGAAAGTCAGTGTTCTTGAAGTACAGCGA
GTTCCTGAGGTCCCAAGTGGAATCTTTGGCACTAAAACTG
TGAGTGAGAAATATGAGGAGACCGACTGCTTTGGGAATAC
TTACTATTCCTCCAAAAGATCTACATTTGTTACCAGGCAG
TCCGAGACTGAATTGTCTTCCTCATATGATGTAGTCACCA
GCCCTAGGAGGTCTGAAGGAATGACTTCACCTGTCTTGCA
AAGATCTGGCCAGAGCTTCTCCTCAAATTCTCTAAGTAAA
GGCAAAGACAGAAAAGTGTTTGTTACTTTTGGTCATCCCA
ACACTGAAAAGCATTAAGCTGGCAGCATTGTTTTTGTAAC
TTTTTTTGGATGATGTCTTGTTTATTTCCATATTTTTATT
TAAATCAATATATGAATTATTGATCTTAATTTTAATGTGT
GTACAATTGAAATGTTATCATGATGCCTTCATTAGGTGCA
TGTTTTTGTACTGTTGCATTTGTGTTAATGTTAAATATTT
ATGTTTGTTTCAAAAAACTGTATATTATCTAAAATAAAAT
AAAAACTTACAAAGCAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations