Transcript

ddx56-003

ID
ZDB-TSCRIPT-090929-7050
Name
ddx56-003
Previous Names
None
Transcript Type
ncRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024167 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024167|OTTDARG00000019626|ZDB-GENE-040825-3 ddx56|no_translation ddx56-003 LG_ CR394525.8 Danio rerio protein_coding KNOWN, 567 bp
ACACGTGTGAAGATGGAGGAGGACAGCGTACGCTTTCATG
AGATGGGTTTAGATGATCGACTGTTAAAGGCTCTGGCGGA
TTTAGGATGGTCTCAACCAACCCTTATCCAGGAGAAAGCC
ATCCCTCTGGCACTGGAGGGGAAAGATCTGCTGGCCCGAG
CTCGAACCGGATCCGGAAAAACAGCCGCCTATGCAGTTCC
ACTGATCCAGAGAGTCCTCACATCCAAACAGGTGATGCCT
TGACGTCCGAGTCGCAGACATCTCTGGAAAAGCAGATCTG
TCTGCTCAGAAGCCCATTTTAATGGAGAAGCCGGATATAG
TGGTGAGCACCCCGTCTCGCATTCAGGCTCATATTAACGC
TCAGAACCTGCAGCTTCACTCCTCATTAGAGATGCTGGTC
ATCGACGAGGCCGATCTTCTCTTCTCATTCGGCTTTGAGG
CGGATCTGAAAAACCTGCTGTGTCACTTACCCAAGATCTA
CCAGGCGTTTCTGATGTCGGCCACACTGAATGATGATGTT
CAGGCCCTAAAGGAGCTGGTCCTCCACAATCCGGTGAGTG
CAGAAGC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations