Transcript

ddx56-201

ID
ZDB-TSCRIPT-090929-7048
Name
ddx56-201
Previous Names
  • ddx56-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024165 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024165|OTTDARG00000019626|ZDB-GENE-040825-3 ddx56|OTTDARP00000019994 ddx56-001 LG_ CR394525.8 Danio rerio protein_coding KNOWN, 1993 bp
ACACGTGTGAAGATGGAGGAGGACAGCGTACGCTTTCATG
AGATGGGTTTAGATGATCGACTGTTAAAGGCTCTGGCGGA
TTTAGGATGGTCTCAACCAACCCTTATCCAGGAGAAAGCC
ATCCCTCTGGCACTGGAGGGGAAAGATCTGCTGGCCCGAG
CTCGAACCGGATCCGGAAAAACAGCCGCCTATGCAGTTCC
ACTGATCCAGAGAGTCCTCACATCCAAACAGACTGTACGA
GAGCAGGCTGTCAGAGCTGTAGTTCTGGTCCCCACCAAGG
AGCTGGGCCAGCAGGTCCAAACCATGATCCGCCAGCTCAC
GGCGTACTGCAGCAGAGACGTCCGAGTCGCAGACATCTCT
GGAAAAGCAGATCTGTCTGCTCAGAAGCCCATTTTAATGG
AGAAGCCGGATATAGTGGTGAGCACCCCGTCTCGCATTCA
GGCTCATATTAACGCTCAGAACCTGCAGCTTCACTCCTCA
TTAGAGATGCTGGTCATCGACGAGGCCGATCTTCTCTTCT
CATTCGGCTTTGAGGCGGATCTGAAAAACCTGCTGTGTCA
CTTACCCAAGATCTACCAGGCGTTTCTGATGTCGGCCACA
CTGAATGATGATGTTCAGGCCCTAAAGGAGCTGGTCCTCC
ACAATCCGGTGACACTGAAGCTCCAGGGCTCTCAGCTGCC
CGACAGCTCACAGCTACAGCAGTTCAGCATCAAATGTGAA
GAGGAGGACAAGTTCCTGCTCATCTACACGATGCTGAAGC
TCGGCCTGATCCAGGGGAAGACGCTCCTCTTCGTCAGCGA
TGTGGACCGATCGTACCGCCTCAAGCTGTTTTTGGAGCAG
TTCAGCATTCCTGCTTGTGTCCTAAACTCTGAGCTGCCCG
TTCACTCCAGGTGTCACATCATCAGCCAGTTCAATCAAGG
CTTCTACAATTACATCATCGCCTCAGATGAGCAGGGATTG
GAGAGTCCCGCTGGAAGCTCACAGAAAACACAAGAGAAAG
GGAAGAAGAAGAAGGGCACAGGGAAAAAAGGCAAAGACAA
GGAATATGGTGTTTCCAGAGGAATCGACTTCCACAATGTT
TCTAATGTGATCAACTTTGACTTTCCAACTTCAGTCGAGT
CCTACATCCACCGTGTCGGCAGAACGGCTCGTGCAGATAA
TCCCGGCACAGCGCTGTCCTTTATTTCTCATGCAGAACTC
TCGATGCTCTCAGAGGTTGAAAACGCTCTTACTGGAGACA
GCAACAATTGTGTTTTGAAGCCATACGAGTTCAGAATGGA
GGAAATCGAGGGATTCAGATACAGATGTCGGGATGGAATG
AGATCGGTGACTAAACAGGCGGTGAAGGAGGCCAGACTGA
AGGAGATCAAACAGGAGCTGCTCAATTCAGAGAAACTCAA
GACTTACTTTGAAGACAATCCCAGAGACCTGCAGCTGCTC
CGACACGACAAAGACCTGCATCCCGCCATCATCAAACCTC
ACATGAAAAACGTGCCTGAATACCTGATCCCGACTGCACT
GAAAAGTCTTGTCAACCCTCTGAACCAACGGAGGAAAAGG
AAGAAGGTGAAATCCAGCGGTGTGATGCTGAGCAGCTTTA
AGAAGAATTACAGAGGCAGAAATCCACTAAAGAGTTTTCG
CTACGCCAAGAAGAGGCGAGGGGAGAAGAAGGCTGGCAAA
CCCTAATGGAGACTTTATGGATTTGGAATTTTGAGGACAT
AGAGCTCTCCTGGAGCTCACTAAACAGCGTATAGTGTGTA
TCTCACACTCATTTTACACAGGATTCAAGACTTCAGCTTT
CAAGTAAAGACCGCAGGACTTCAATTGGATGCGTGTGTGT
GTGTCAGTGGTAAGTGGGTTGAGAATCACAGTCTGGACAC
AACATGAACATTCAGTCGACTGCTTTTGATTAAGTGACTG
TTTGAAATGTTCCTTCTGAATATTGAACGTATAATATTGT
ATGTTTTGTTAATACTAAAAGCTCTACTTCGGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations