Transcript

ilk-002

ID
ZDB-TSCRIPT-090929-6944
Name
ilk-002
Previous Names
None
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024015 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024015|OTTDARG00000019524|ZDB-GENE-040426-1435 ilk|no_translation ilk-002 LG_ AL928852.7 Danio rerio protein_coding KNOWN, 803 bp
GGACGCTGGAAGAGTGTCGGGTCCAGACCGTCCCAGTCAT
CTCCGTTGGTCCACTTCAGCTAAAAGCGGCCATATAAACA
GTGCAGCGCAGACACCAGACACTTGCCCTGAGGCTGTGAA
GAGACTGTCCCATCGCACCCTTCCCGTTGCTGGATGTCCT
GTCCGCCCTCACCTGTTCTCTTCAGGGTCCAGCTGCATCA
AACGCCTCTTCCAGGACACTCCTGGTAGGAGGACGATCCA
TTGGGATAGTGTGAGAGGAGAGAGGGTGCCGAAATGGATG
ACATCTTCACTCAGTGCCGTGAAGGCAACGCGGTAGCCGT
TCGCCTCTGGCTGGACAACACAGAGAATGACCTAAACCAG
GGGTGAGTGCATTCTTGAGAGTTTGCAAGGGTCATAATAC
GAGCTATTTTTAGAAGGTTTGACGTGGGCTTGTAGAATTT
GCTTATTTGTGGTCTTGTACAGACTTTCTGTCAATAGGGG
GCGGATTCTTGAAATGTTGTGTGTGTTTTGTGACGAGCTT
TTGTCTGGTCTTGTCCCCTAGTTCACCCCTTACACTTTTA
TCAGTCTTGTAATCCCTAGGCGCAGTGGTGCAGTGACTCA
AAGGCAATGAGGGTAGATTTTTATCAGGTTTTGTTTGTGG
CACAGATTTCATTCAGTTATTTGGTCTGTCGTGGCAGTAC
AGGTATTTTTTTAGATTAAATAGATGATTTTGAGGATTTA
AATAGATTCAATTCAATTTGCTTATTTGTGTATCACTTTT
CATTGTACCAAAAGTATTGTACCAAAACAGCTCTACAAAT
GGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations