Transcript

ucp3-201

ID
ZDB-TSCRIPT-090929-6936
Name
ucp3-201
Previous Names
  • ucp2l-001
  • ucp3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024007 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024007|OTTDARG00000019521|ZDB-GENE-040426-1317 ucp3|OTTDARP00000019877 ucp2l-001 LG_ AL845435.20 Danio rerio protein_coding KNOWN, 1676 bp
CTGACAGGCCGGTTCCTCCAAAATCAGGTGGAAAACACAC
TCGCTGGATTAACCCCTGCATGGATATTATCATCTCGCTT
TCTGTCGGTACAGTTTGGACTAACAATTTCATATTACGGC
AAGTGTTGTGCTGCTGTTATGCTGCTTTGGGACATTAAGG
ATCAGTTTTTTATGGCCAAAAGTGTTGAAACATCTAAAAC
AGAAAATATCCTTTTGGAAAAAACTTGAAGTGAACCGACG
TGGAGGCGGGAAAACACAAGTTGAAAGTAAAAGTATAATT
CCCTTGCTGCGGTTTTCTGTCAGAAGTGAAAAATGGTTGG
AATTAAACCTACCGATCTGCCTCCAACCGCTGCTGTCAAG
TTTTTCGGAGCCGGTACAGCAGCATGTTTTGCTGATCTGG
TGACTTTCCCCCTGGACACAGCAAAAGTCAGACTTCAGAT
CCAGGGAGAGTCTGGAACAGCACCAGGATCAGCGGTGCTG
AAATATCGTGGGGTTTTTGGCACCATCACCACTATGGTTC
GCACGGAGGGGGCCAGGAGCCTCTACAATGGCCTGGTGGC
AGGACTGCAGCGTCAAATGAGCTTTGCTTCTGTGCGCATC
GGCCTTTACGACTCAATGAAGCAATTCTACACCAGAGGAT
CTGAGAATGCGAGTATTGTGACGCGTCTGCTGGCTGGATG
CACCACAGGGGCCATGGCGGTCGCATTCGCTCAGCCCACA
GACGTCGTAAAAGTGCGCTTTCAGGCTCAAGTGCGTCACA
CTGACGGAGGAAAGAGATATAATGGCACAATGGATGCCTA
TCGGACTATTGCCCGTGATGAGGGTGTTCGAGGACTCTGG
AAGGGCTGCATGCCAAACATCACAAGGAATGCGATCGTGA
ACTGCGCAGAGCTGGTCACCTACGACATCATCAAGGATCT
CATATTAAAATACGACCTCATGACAGATAACCTACCCTGT
CACTTCACGGCTGCATTCGGCGCTGGTTTCTGCACCACGA
TTGTAGCGTCTCCAGTAGACGTGGTGAAAACGCGGTTCAT
GAACTCGTCGGCCGGCCAGTACGGCAGCGCACTGAACTGT
GCCCTCATGATGCTGACCAAAGAGGGACCAGCCGCTTTCT
ACAAGGGCTTCATGCCCTCCTTCCTGCGCTTGGGATCCTG
GAATATTGTGATGTTTGTTTCCTATGAGCAAATCAAGAGG
TGTATGACTCGAATGCAGCACTCGTGGGAATCGCCTTTCT
GAACACACAACATCAGTATCTTCTAACTGTGACTGAACAG
ACAGCAAATATAACTCAAACGCCCTGTTGTGAGAATGGAG
GAATCCCCATCTGAAGTCTTATCACTGAAAAAAGGCTGCA
GTGTTGTAAGGCCAAAGGTCAAGCTCATCAAATATGAAAG
ATGAGTTAGCAAAGTGCCCGATGAAGCAAAATGTGCATAT
TGTCTGTTTTAGGGAGTTGGAAAAAGCACACTCTTAAAGA
AACAGTGCAGGGAAAAACAAAAATGCCTTTTCACATGGCT
TTTCTTTGACATATTTTGAGTAAATCATCAGTGCCAGTAA
ATAACCTTTATTTTGAAGTGTGTAAATGTTTTTATATATA
CATATGTTAAATGTTTCTAAAACTGTCATGAATACGGGTC
CATAAATTCTGATCAATAAATGTATATTTATACTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations