Transcript

lap3-201

ID
ZDB-TSCRIPT-090929-6930
Name
lap3-201
Previous Names
  • lap3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000024001 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000024001|OTTDARG00000019519|ZDB-GENE-060719-1 lap3|OTTDARP00000019875 lap3-001 LG_ BX901913.8 Danio rerio protein_coding KNOWN, 2087 bp
CGTCAGTATCTGCGACAATTATTTGCGGTGGTTCGCAACT
CTCCAATGTCACGTGTAAAAAGCTTTTTAAGAATTATCTA
TTGAATCACGGTTGAGTTGAGTTGTATATTATAGACGATG
CTGATACCGTTCAGAAGGGCGTTGCTTACAGCAATCCGAA
AACACAACTGTAGGCTGTTTTCTGATTCCACTGTCACTTC
CAGTACACGAAAAGGCTTAGTTTTAGGTGTGTATGAGCAA
CAGTCGGACAGTGATGGGGTGTCTCTCACGGAGGCTGCTG
CGGCGTTTGACAGGTCGCTCTCCGGGAGACTGTCAGAAAT
GCTCTCGCTATCTGGACCTCCCCTGAAGAAAGGCAAGAGC
AGGATCTTCTATGGTTTACATCAGGACTTCCCTAGTGTAG
TTGTGGTTGGCCTTGGCAAAAGTGACCCAGGTGTGTGTGG
GAAGGAGAACTGGGACAACTGTAAAGAAAACATTCGTGCA
GCTGTGTCGGCGGGCTGCAGACAGCTTCAGGATTTGGAGG
TTGCTCTCGTGGAAGTGGATCCTTGTGGAGATGATCAGTC
AGCAGCAGAGGGCGCTGTGCTTGGCCTTTTTGAGTATGAT
GAGCTCAAGACCAAAAAGAAGGTCCATGTCAAGACCCGAC
CACATGGGAGTGTTGATGCAGCAGCATGGCAGAAAGGTGT
TCTGTATGGGGATGGGCAGAACCTGGCCAGACAGCTGATG
GAGGCTCCTGCCAATCACGTCACTCCCACTGTGTTCGCAA
ATACTATCGAGCAGAAACTCTCACTTTTTGCTGATAGAGT
GATTGTCCACAAGAGGCCTCAGTCTTGGATTGAAGGTGAG
CAAATGGGGGCTTTTCTCAGCGTGTCTAAAGGCTCTGAAG
AGCCCCCTGTCTTTCTGGAGCTGCATTACAAAGGCAGTTC
AGACTCGGCACAGCCTCCTCTTGTGCTGGTGGGCAAAGGA
ATCACCTTTGACAGTGGTGGTATATCACTTAAACCATCTT
CAGGCATGGATGCCATGAGAGCGGATATGGGTGGAGCAGC
CACTGTGTGTTCTGCTATCGTGACAGCAGCTGCTCTGAAA
ATCCCCATTAATATAATCGGTTTGGCACCACTCTGTGAAA
ATATGCCAAGTGGAAAAGCAAACAAGCCGGGTGATGTTGT
TCGCGCCAAAAATGGCAAAACCATTCAGATTGACAACACT
GATGCGGAGGGCAGACTGATTTTGGCTGATGCTCTCTGTT
ATGCTCATAGTTTCAAGCCCAGAGCAATAATTAATGCTGC
TACGCTCACAGGTGCCATGGATGTGGCTTTAGGTTCTGCT
GCCACTGGAGTGTTCACTAACTCTGATTGGCTGTGGGAGC
GGCTACATAAGGCCAGCGTTGTTACTGGTGACAGGGTGTG
GAGGATGCCACTGTTTCAGCACTACACCAAACAAGTAACT
GACAGCGCTCTGGCAGACCTGAACAACGTTGGAAAATACA
GCCGTTCTGGTGGCGCCTGCACCGCTGCTGCCTTCCTCAA
AGAGTTTGTGAGCGCCAATCACTGGGCTCATCTGGACATC
GCAGGGGTCATGACCAATAAAGACGAGGTTCCGTACCTGA
GGAAAGGAATGTCTGGAAGACCCACGCGCACTTTAGTAGA
GTTCATTGCTGGTTTGGCCTCTGACGTGTGACCTTTGATC
TGGCCAAAGTATATCCACGATGATCAGTGTTCAGAATAAT
AGTCAATGGTTAGAAATACATTTGCTGCCAGATTTAGCAG
AGACCTTTCAACAAGTGATCAAGAAACACAGAAGAAACTT
TTCATGGCAAGAACAAAAAAACAGTATCTTATGGAAACTG
CTGACAAGCGTTACTAGAAACTGCAAGGCTGTTGCTAAAT
TCTAGTTACACTGTAACTGGTAACAAAACTAGAGAATGAA
AGACCGGTTTAGCGGATTGCCTTTTAAAACAGTATTGGGT
TAAGAAGTGGCACAAAGTTCAACTTTTTAAAATTCAGCAT
ATTTGTGTAAAAAGGATACATGGTGCCAGTGTTATATCAT
GAAATATCAAGAAAATAAGGTCAATAAAGTCCTGTGGCAC
TGAAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations