header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-693
Transcript Name: lft1-201
Previous Name: lft1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006263 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006263|OTTDARG00000005740|ZDB-GENE-990630-10 lft1|OTTDARP00000005572 lft1-001 LG_ BX470246.11 Danio rerio protein_coding KNOWN, 1381 bp
GCACAGCAGTGACAGCTTCTCCTGCACCTTGAAAAGATGA
CTTCAGTCCGCGCCGCGTGCCTCCTTTGCGCAGCACTTTT
CGCGATGGCTAGGGGTTTCACCCACGAAGACATGAAAGAC
GCTCTGCTGAAGAAACTGGGACTTAATGAAATTCCGCAAA
TTCACAAGAGGGATCTGGAGAACCTTGTGATCCCAACGAA
CGTAAAGAACAAATATATCTCCATGCTGAAACTTCACCAC
TCAAGAAAACGCCGCTCGCTTCCCAGTTTGGCCGGCATCC
TGAGGGGAATTCCTGGAAATGCAGACATATCTGGTGAATT
CGTATATTCTGACACGACACGTCAGCGTGTGGTCTTTGAA
ATGACATCAAGAATCCCCGAGAACAGTGAAGTGACCATGG
CAGAACTGAAGCTCTACAAGAAGGCCCCACACAAGCGCTC
CATACCGGAGAGAAAGGGCCACAGACCGGTCAACAACGCA
CGAGTGAGCATCTACTGGGTGGAACCTCAGAAAGACGGGT
CAAACCGAACTTCACTAGTGGATTCCAGGTTGATTCCCAT
TCACGAAACTGGCTGGAAGAGCTTTGATGTCACCCAGGCG
GTGCAATATTGGTCTAGGAGCCGAATGGAGATGCCCATGC
ACCTTGAGGTGTGGATCGAGGGCGAGAGACCCGGCAGTTA
CGCGGCAGAGATGGCCAAGTGTGTCCACTTCACAACTCAA
GACCCAGACGACAACACTCTGGGAAAACCAGAGCTGGTGC
TTTACACACTCAACCTAGAGGAGTTTGGGTCTAGTGGAGA
CTGTGAAAACAACAAAGACCGTGAAATGTGCTGCAGGGAA
CAGTACTTCATCAATTTCCGAGCTCTGACTTGGACACAGT
ACTGGATCATCGAGCCGTCCGGTTACCAGGCGTTCAGGTG
TAAAGGCGGCTGCCGGCAGCCAAAGCGCAACTACGGCTAC
GGAGAGAGGAAATGCGCGGTCGTCGAGAGCGCGCCACTAC
CGATGATGTATCTAGTAAAAAAGGGAGATTACACAGAAAT
AGAAGTGGCTGAATTCCCAAACATGATTGTGGAAAAATGT
GGATGCGCAATGGACAATATTTCAGTTGTATAAATAGCCT
GTTTGTATCGACCAGCTATCTTCATGACGCACTATACTAC
CTAAACTTATAAGATTTAGAATGGGTGTTGTCAATTTAAC
CCTTACTAGATACCTCGAGCACTTTGTATAGACTTGTAAA
TAGAGCTAATCTGATATGCGTTTATTTTTGCATTTGTATA
TGATGCCATTGATTTGTAGATGTTTTATTTTGAGCATATA
GCACGGGTTTGTTGTATATGTGAGACTGACTGAATATAAA
TTAAACTATTTTTCATTGAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lft1-201 Contained in:
[BAC] DKEYP-8F4 (1)

OTHER lft1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000006263 (1)
  • Ensembl_Trans:ENSDART00000019196 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:AF172089 (1) 1381 bp
    GenBank:AF132444 (1) 1376 bp
    CITATIONS (2)