header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6872
Transcript Name: med19b-202
Previous Name: med19b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023935 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023935|OTTDARG00000019476|ZDB-GENE-040727-4 med19b|OTTDARP00000019826 med19-001 LG_ BX511158.5 Danio rerio protein_coding KNOWN, 1177 bp
AGACAGAACGTTACGGACGTTAAGTAATTGTCAACCGAAT
ACAAACGTCCATACAATTAAACCGTCGCAGGCTCGCAGCG
TAGTTTTTGTCATCATGACAGAAATCTTCTCCTCGTTGTA
TGGCCAGCCTGATTCCCAGGGCCCCGCAGGACCGTCCGCG
CTGGGCTTTGGCTCTGGGAAACCTCAGGTCCCCCAAAACA
TGGGCCCGATGTGTTTCCCGCATCAGATGATGGAAGAAGG
GGCTCCGGTCAGAAAACCGGCTGCGATGAACGAGCCCTTC
TATCTGCTGAGAGAACTGCCCATGGAAAATGAGCTGACGG
GACACACTAATCTCATCACGCACTACAACCTGGAGCACGC
GTACAACAAGTTCTGTGGGAAGAAGGTGAAGGAGAAACTC
AGCAACTTTCTTCCTGAGCTTCCTGGTATGATAGACAGCC
CAGGCATTCAGGACAACAGTTCTCTGCGCTCTCTCATCGA
GAAGCCTCCTGTGTGCAACAACTCTTTCAGTCCTCTGACC
GGAGCCATGCTCACCGGCTTCAGGTTACACACTGGCCCTA
ATCTGCTGGGATTTTTTGTGTATGTTTTATCTGACTCTAT
GTCTGTCTTGCTGAAGTTACCAGAGCAGTACAGACTGATG
CACATTCAGCCGCCTAAGAAGAAGAACAAACACAAGCACA
AACACCATCGACCTCAGGACCCCTTACCACCAGAAACTCC
GTCAGATTCAGACCATAAGAAGAAGAAGAAAAAGAAGGAC
GATGACCCGGACAGAAAGAAAAAGAAGAAAGATAAGAAAA
AGAAGAAGAATCGCCACAGCCCTGATCACCCAGGCATGAC
CGGAGCTCAGCCCAGCACCAGCAGTTTGAGATAAAACTGA
AAAACAAGAGGAAAGTGTTACAGTGAAGCACAAGCTGGAC
AATTGGGCTTTTTACCGGATGTCCCACAATTGATGTTACA
GTAAGAATCAGATGCCAGGTTTGTGTGTGTGTGTGTGTGT
GTATTGATTACGTAATGTATTAATTACCAGATGATCTGGT
AAAGCGTTATATTTGTAAGTGCCTCAGTGTCTATTTATGA
GTTCAATGAAAAATGTAACATTTTTCATTCAGCTTTTTTA
AACGTTTTTTTGTTTTTTGTTTTTACAAATAAAACAATCA
GCTGAGAAACTGGCTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
med19b-202 Contained in:
[BAC] DKEY-28B4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000023935 (1),  Ensembl_Trans:ENSDART00000137980 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC092743 (1) 1165 bp
GenBank:AY648741 (1) 1020 bp
GenBank:CN836973 (1) 904 bp
GenBank:CT606353 (1) 790 bp
GenBank:CO958348 (1) 766 bp
GenBank:AL724795 (1) 595 bp
CITATIONS (2)