Transcript

elmod2-202

ID
ZDB-TSCRIPT-090929-6790
Name
elmod2-202
Previous Names
  • elmod2-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023839 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023839|OTTDARG00000019417|ZDB-GENE-060824-2 elmod2|OTTDARP00000041319 elmod2-002 LG_ AL935166.14 Danio rerio protein_coding KNOWN, 1110 bp
ATTTCCGGGAGAGGACACTGCTGAGGATGCTGGGATATAT
CTGGCAGTGTTTCTATTCCTCCTGTCTGCGCTTCTGGTTG
AAGTGGTTCCTTCGGCTGGTCACGGGAAGATGTGAACTTC
AGCGCATTTGTGCCCGATGCAAAGCTGGAGCTCTGAGGAC
TTCACAGATAGAGTATTCTCTGAAATCCTCCAAAAGCAAG
GTTTTGCAAACAGCTTTATCTGTGAAGCAGAATGAATTGG
AGGACCGCCTGGCTCAAATAATACAGGAGAAGAGAATCAA
GGAGCAGAAAGACCCCACGTTTAAGGTCAATCTTCGTCAG
TGCTTGTTACAAATAAACGGATATAATGAGCTGTTTGAGG
AGGTGGAAGAGCTGAGGAAGAAGGTGTTTGACTCTGAAAA
TGAACAACATGAGAACATGCTTCTGAAGCTTTGGGATTTG
CTGATGCCGTCAGTAAAGCTGGAATCCAGGATCACCAAGC
AGTGGGGAAACATCGGCTTTCAGGGCGACGATCCCAAGAC
GGATTTCAGAGGCATGGGGATGCTGGGACTCACAAACCTG
CTGTAGGTCATGTTTGTTCTCATTGCTTGAGGAGAGTTCA
TCAAAATTGAAAATGTACTGCTGATTTGCTCATTCTAAGG
TCATCGAAGATGTAGGTGACTTGTTTCTTTAGTAAGGCAT
TAAAGCAGATCTTTTATGCCCCTTTTATAAGATGTAAAAT
AATTCTCCGATGTCCCTTGAGTGCGTGTATGAAGTTTCAA
ATCAAAATATTCCCAAATTATTGTTTTATAACTGACCCGT
TTAGACTTTGATCCTAATTGTGCTGTTTTGGTAATCGTCG
CTTTAAATTCTAATGAGATTGTGCTCTTTTTTTCAGAAGA
AGGTGGAGCTACAAATGCCTGTGTGTCAGCATAGCAGCAG
ATTATAATGTTATAAGTGATGATGTTATAAATCAGATTCA
GTATCTTGCACGGACTGATCATTTAACTTCATAAGACCTC
AGTGTGTCATCAGGAGCCAGACGTTTTCCTTTTGTATTGC
TTGTATGTGATTCTTTTGACTCAAAGTGCTGAAAACTACG
GAAGCCCATTCCTGCCACTGAATAAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations