Transcript

elmod2-203

ID
ZDB-TSCRIPT-090929-6789
Name
elmod2-203
Previous Names
  • elmod2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023838 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023838|OTTDARG00000019417|ZDB-GENE-060824-2 elmod2|OTTDARP00000019758 elmod2-001 LG_ AL935166.14 Danio rerio protein_coding KNOWN, 5349 bp
GCACCAATACGAATCATTTCCGGGAGAGGACACTGCTGAG
GATGCTGGGATATATCTGGCAGTGTTTCTATTCCTCCTGT
CTGCGCTTCTGGTTGAAGTGGTTCCTTCGGCTGGTCACGG
GAAGATGTGAACTTCAGCGCATTTGTGCCCGATGCAAAGC
TGGAGCTCTGAGGACTTCACAGATAGAGTATTCTCTGAAA
TCCTCCAAAAGCAAGGTTTTGCAAACAGCTTTATCTGTGA
AGCAGAATGAATTGGAGGACCGCCTGGCTCAAATAATACA
GGAGAAGAGAATCAAGGAGCAGAAAGACCCCACGTTTAAG
GTCAATCTTCGTCAGTGCTTGTTACAAATAAACGGATATA
ATGAGCTGTTTGAGGAGGTGGAAGAGCTGAGGAAGAAGGT
GTTTGACTCTGAAAATGAACAACATGAGAACATGCTTCTG
AAGCTTTGGGATTTGCTGATGCCGTCAGTAAAGCTGGAAT
CCAGGATCACCAAGCAGTGGGGAAACATCGGCTTTCAGGG
CGACGATCCCAAGACGGATTTCAGAGGCATGGGGATGCTG
GGACTCACAAACCTGCTTTTTTTCAGTGAGAAACACACAG
ACGCAGCCCGGCAGGTTCTGTCACATGCAAATCACCCCAC
ACTCGGGTATTCATATGCCATCGTGGGCATCAATCTGACA
GAGATGGCCTACAGTTTAATGAAGTCGGATGCTCTGAAGC
TTCATTTCTATAACAGTGTGTCTGGAAAAGCAGAAATGCA
GCACTTCCATCAGTTCTACTGTTACCTGGCGTACGAGTTC
GATAAGTTCTGGTTGCAGGAGGAGCCGGAGAGCATCATGG
AGTTTAATCGCTACAGAGAAAAGTTCCACGACAAGGTCAA
AGGTCACCTTCAGGAGCCAGAGGTCACACTCACCTTGACC
CCAAATCCAGAAAACTGATTCCCAATGCATTCCAGATCAA
TTCAGAGACAAGACAAACCACAGCCGTTCTGTTTGTTTTG
GCTGACTTTTAGTTTAGTTCAACGTGCATGAAACCTTATT
TGAATAATAATTAAACTGCGGTGTAAACGGTACATCAAGT
GTACATAGCTGGTGGTTTAGCTGCGTTTACCTGGTCAGGG
AACAGACTCACACTGTTAAGTATTACTCATAATAAATTAA
AGCAAGACACTGCTGGTGAAAAAACTGAATAACTAAAAAT
GAGCTAATATTTACAACCATACGTCTCCAGTTAATTGACT
GATTAAGCAATTGCGAAATGTTTTTTGTATTATTAATGTT
TTAAAAATGATGTTTAGACGTCCAATTGAGGCTTTATCTA
ATTAAATATGATCTCATTTCAAGCAGAAACATCTGAAATC
TGGATGAAATTGAGTTAGAAATTGTTTTATTTGTTTTGTT
CGAAAGTCGTTTGAGGCCATGCATTAGTAGAATTTTCTTT
TTACTTATCACAACTTAATTTAACTCAACATGTTTTATAT
ATCTATAAAAACTGTTCCTAATCTAGAACATCATCTTATA
TAGACGTCATAGATTCAAGAAAACAACTTATGCCTAAATC
ACAAAAAAAAACATATCTATGTTATGTTGAGATTACAAGA
ACATTGTCAACATCACAAGAAAAATATTTTTGTTGATGAA
ATCACATGAAAATTAGGTCATCATCACTAGACAGACAATT
TCAACCAAAATTGTTTTCTTGTGATTGAAACTTAATTTTC
ACACGATTTCGACAAAAATTAAGTCGTGAACACAAAATAC
AGATTTTGTTGGGATTGCATGAAAATTAATTTGTGATCAT
AAGAAAACAACTTTTGGCAAAATATTGTGAATTTTCGACA
AACGCTATTTTCTTGTGATCATGACTTATTTTTCATGCGA
TTCCGACAAGTTGTTTTCCTAAGTCGTAATTGCTAGAAAA
CTTTTTTCGAAATCATGCAAAAAATTGAACCCTGATCACA
AGAAAATAACTTTTGTTGAAATCAATTGGACATATGTGAT
CACAACTGAATTTTCAAGGGACTTTTCAATGTGATCATAA
CTTTTCGCATGAGTTCGACAAAAGTTATTTTCTTATGATC
ACTTAGTTTTCATGCAATTTAAACAAAAGTTGTTTTCTTA
AGTGGTGATCACATGAAAATATTGTCGAAATCACATGTAA
AACAACTTTTGTTCAAATCATGTGAAAATTTACACTATTT
TGACAAATGCTGATTTATTGTGATCATGACAACATAGCAA
TTTATGTCGAAATTGCATTAAAATTTAGTAGAAACTTTAA
CTTATACATTGACTCGGCAAAAGCTGTATTGTGATCACAA
TCAAGTGAAGAGTCAAGATCACAAAATACAGATTTTGTCG
AGTCAAAGACAATAATTCACACTATTTTAAAAAAAACTGT
TTTATTGTGACCACAAATTAATTTTTGCATGATTTTGACA
ATTTTTGTTAACTATGTTAACAACAAGTTGTTTTGTGTGA
TCACAATCAAGCTAAAAGTCGTGATCACAAAATACAGCTT
TTGCTGAGATCGTATGAAAATTAAGTCGTGATCACAAGAA
AACAACTTTTGTCCAATTCATGCAAAAAGTTATGATAGCA
AAATACATATGTTTTCGAAATTGCATAAAAAACTATGTTT
TAACTACAAGAATACAACTTTTCTTGAAATTGTGTGAATT
TTAAATGTAATTTCCACAACCTAATGTTTATGCAATTTTG
AAAAGAGCTCAAAAGTTTTCTTGTGATCACAATTACATTT
TCACAAGATTTCAACAAACAATTTTTTCTTAGGGTCGCGA
ATTATTTTTTTTATGCAATTTCAACAAAAGTTGTTTTATT
AAGTCATGGTCTTTAGAAAACCTTTTTCAAAAACACAAAA
AAATTTAGTCACAAGACAAAACTTTTCTCGAAATCACATG
AAAATTCACAGTATTTCGGCAAAAGTTGTTTTATTATAAT
CATGACTTAATTTTCATGAAATTTCAACAACAGTAGTTTT
CTTATGATTACAAACAACTTAAGATAACTTGTATTAATAT
CACATAAATATTAAGTCGTAATCACAAAAAAAACAACTTT
TGTCAAAATCTTTCGAAAAGTTACGATCACAAAATACAGT
CTTTTTCAAAATAGCATGAAAATTAAGTTGTGGTCATAAG
AAAACAACTTTTGTCAAAGTCACGTGATCATTTGTTTTAA
TTTGTGATCACTAGTATCATGCAGAAATTCACACTGTTTC
ACTATACAAAGTTGTTTTATTGTGGTCGCACCTTCATTTT
CGCGTGATTTCAACAAAAGTTGTTTTATTGTGGTCATGAC
TTAATTTTTATGCAATCTCGACTGAACTTGTATTTTGTGA
TTACAATCAAGTGACGTCTTGATCACAAAATAAAACTTTT
GTCGAGTCAATGTTTAAGTTAACGTTTTGACAATCTTCAT
GCGATTTCAGTATAAGTTATCATAAGTCATTATCACAAGA
AAAACAACTTTTGTCAAAATCACATGAAAATTAATTCATG
ATCACAAGAAAATCAACTTTTGTTAAAATCACATAGAAAT
CCACAGTATTTTGACAAAAGGTTTTATTGTAATTACAACT
TAATTTTAAACAAACTTAACAAACTACTTTTAATGCGATT
TCGACAAAAATTGATTTATTGTGATCACAAACTACTTTTA
ATGCGATTTCAACAAAAATTGATTTATTGTGATCACAACT
TAATTTTAATGCAATTTCAACAAAAGTTGATTTATTGGTA
TCACAACTTAATTTTGATGCGATTTCGACAAAAGTTGTTT
TATTGTGATCACAAACTAATTTTAATGCGATTTCGACAAA
AGTTGATTGTGATCACAAACTAATTTTAATGCGATTTCGA
CAAAAGTTGATTTATTGTGATCACAAACTAATTTTAATGC
GATTTCGACAAAAGTTGTTTTATTGTGATCACAACTTAAT
TTTGATGCGATTTCAACAAAAGTTGATTTATTGGTATCAC
AACTTTATTTTGATGCGATTTCGACAAAAGTTGTTTTATT
GTGATCACAAACTAATTTTAATGCGATTTCGACAAAAGTT
GATTGTGATCACAAACTAATTTTAATGCGATTTCGACAAA
AGTTGTTTTATTGTGATCACAACTTAATTTTGATGCGATT
TCAACAAAAGTTGATTTATTGGTATCACAACTTTATTTTG
ATGCGATTTCGACAAAAGTTGTTTTATTGTGATCACAAAC
TAATTTTAATGCGATTTCGACAAAAGTTGATTGTGATCAC
AAACTAATTTTAATGCGATTGACAAAATTTGTTTTATTGT
GATCAGAAACTAATTTTAATGCGATTTCGACAAAAGTTGA
TTTATTGTGATCACAAACTAATATTAATGCGATTTCGACA
AAATTTTATTTATTGTGATCACAAACTAATTTTAATGCGA
TTTCGACAAAAGTTGATTTATTGGTATCACAACGTCATTT
TGATGCGATTTTGGCAAAAGTTGTTTTATTGTGATCACAA
CTTAATTTTAATACGATTTTGACAAAAGTGGTTTTATTGT
GATCATGACGAGAAAACAAGAAAAAGAAATATGATGCATG
ATCTCTCGCGGCTCTTATAGTTTTGAGACATTAGTGTCAG
TTTTTTCAGAGGGGATTACGAGAATCTCTTTTTATCACTA
CATCATTCAGATAATACTGTGAACAGCCACAAATAAATAT
TTCAATAAACTGAAATGTGGGGAAAACTTTTTAAGGGACA
TTTTTGATTTTGTGCAGGAAAAAGACTTCTTGAAGTCTAC
AAACAAAAAATGTATGAAGAGCATTTTTTTAGACAAACAC
TTTAAAAGCCCAAAAACTTCTAAAATGCATTAGAAATTAC
CGATTTTTGCCTGCAGTGTCTGGCCTTAAACATGTTTAAA
TCAATCTAAACTCCCTTCACACTTGAATGTTTGCTCATGG
TCACATTGTTCATCTCAGGAAGCTGACGTTTACGTTCATG
TTCATAAGACCTTTAGGAAGATGTTGTTTTCTTGAATATG
CAGATGATGATTTGACCTCTTTGCATGATAAAGTGTGTTT
AAGTTGTATTAAACCCTGCACAGATCCTTCCCGTGGCCTA
TATCCAATGATATTTAATAACTGTGTGTGTGTTATAAGTG
TGAATATTGTTCTTCAGACCTCAACTCGATTCCAAAGTAC
AGCATTTGTGTGCACAAGCTGATGTTGACGTGTGACGTCT
TATTTATAAACCGTGTTCAAGATGTAACTTTTTATTCCTG
ACGACCCGATTCATTTTATAGAGGTCATTCCTAATGTTGA
AGATTAATAAATCAGTGACTGAATATTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations