ZFIN ID: ZDB-TSCRIPT-090929-6697
Transcript Name: otpb-201
Previous Name: otpb-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023719 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023719|OTTDARG00000019338|ZDB-GENE-990708-7 otpb|OTTDARP00000019672 otp-001 LG_ BX470070.27 Danio rerio protein_coding KNOWN, 1845 bp
ATAATACGTGGAACCGCCTTTTTAAACGCACTGACGACTT
TGCTTCAATTGAGCCCTATGCGCTTTTTAAAAGGGTTAAA
GTTGTAGAGTAGTTTGGGAAGCAGTTGTGACTCCAGCAGT
GCGCAATGCTCTCTCATGCCGACCTCTTGGATACTCGCCT
CGGGATGAAGGATGCTGCAGCCGAGCTTCTCGTACACCGA
GAAGCTTTAAAATGCAGACTAGGGGGGACTGACTCTGGAC
ACCCCGGCGACCTTACTTCTGCCACAGAGACTGTGGAGGG
GACCACTCTGCTCCCCGGAGAAGAAATAAGTAATGGTGGA
TCCAATCCTAATGGAATGCAGCAGGTCAACGCCAAAGACC
AAGAAAAGCAGCAACAGCAAAACTCCAATCAGACGGGCGG
CCAGCAAAACCAACAGAAACAGAAACGCCACAGGACCCGT
TTTACTCCAGCCCAGCTGAACGAACTAGAAAGGAGCTTTG
CTAAAACCCACTATCCTGATATTTTTATGAGAGAGGAACT
TGCATTAAGGATTGGTTTAACGGAGTCACGGGTTCAGGTA
TGGTTTCAGAATAGACGTGCAAAATGGAAGAAACGAAAGA
AGACGACCAATGTTTTCCGGGCGCCGGGCACTTTGCTGCC
AACACACGGTTTGCCTCAGTTCCCGTCTGCGGCCGCGGCT
GCGATGGGCGACAGTCTCTGCTCTTTTCATGCCAACGACA
CTCGCTGGGCCGCGGCTGGGATGCCGGGGGTCTCACAGCT
GCAGATACCGCCGTCGCTGGGTCGACAGCAGGCGATGGCA
CAGTCCCTGTCTCAATGCAGTCTCGGAGCGGGTCCGCCAC
CAAACAATATGGGCCTTTCGGGCAGCTTATCGTCAAACGG
TTCCGGTCTTCAGTCGCATCTCTATCAACCCACATTTCCC
GGGATGGTGCCCGCTTCCCTGTCGGGTCCAACGAATGTTA
CCGGCTCTCCTCAGCTGTGTAGCTCCCCAGACAGTGACAT
GTGGAGAGGGACTAGTATCGCTTCCCTTCGCCGTAAAGCA
CTTGAGCACACCGTTTCAATGAGTTTCACTTAATCTGAGC
ACCCGCGATGTCTTTTTCTGTCACTACAAACCTCAAGTAT
TCCTGAAAAACAGTCATGGAGCACTCAGGATGCGAGGTTC
TAACGATGAAATTACAATTTGGCAGCCTTACTGGATGATG
GAATCCCAACATACCCTCAGACAATGCTTACAGCAAATGT
AGACTAGTGTTAGTTTTAATGCTTGAAATGTATGTAATTT
ATTTAAGTGTTGGATTCGTTCATGTTTATTTGTTTATTTT
TATAGAAGTTGATTTTAAAAATGGGGAATTGTTTATTTAT
TTTTGAGTATTTATTTGACTCTTCGTTCATATATGAATCA
ACAGCTGCAAGTATATTTATTTCGCTGTTCAGTGATATTA
TTTTTTATTAAACCTACTGTAAAAGGACAATTATAAACGA
GGACCACATATGTGCATGTACAGGTTGTTTCAAGGCACAA
ACTACATGTTGGAGCGATTTTTCAGGTACAGAAATGAACA
CGTTGGATTAAGAGCCAATTTCCAAATAACCAGATTCGGA
TGCATGTAATATTTCAAACGGGATCAACAGGAAGTTGTTT
ACAAAAGCAAAATGAACTTGAGTGTTTGTGTAGATAAGAC
AAAAAATAATGTTATCTGCTGGTACGTTTGTGATATGTTT
TAACTTATTGTCTGTGCTTATTACTGAAATATGGTTTTCG
TAAATGTTTATCTTACCAAATTCAACAGAATTGGGAAGGT
TTATATCAATGATTGTTAAGTGGGTGAATAAAATCATTTT
AAGAA

otpb TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA otpb-201 1845
otpb-202 (1) 1825
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
otpb-201 Contained in:
OTHER otpb-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023719 (1)
  • Ensembl_Trans:ENSDART00000081249 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076366 (1) 1861bp
    GenBank:CK397178 (1) 825bp
    GenBank:CF673291 (1) 425bp
    CITATIONS (2)