header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6601
Transcript Name: aplp2-201
Previous Name: aplp2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023553 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023553|OTTDARG00000019236|ZDB-GENE-061009-28 aplp2|OTTDARP00000019568 aplp2-001 LG_none BX908399.34,CT573112.10 Danio rerio protein_coding NOVEL, 5379 bp
GTCGGACACGCGCAACATTCCACGCGCGCTGAAAGCTGGA
TCAACGCACAGTGAGGAAAACACAAGCAAAGAGAGACGCA
CACTACAACCGCCCGAGGACCGTTTACTGAGCTCTTCTCC
GTTTCATAGCCTCGAAAATCAGTCCACAGCGGGATATTTT
CAGCACAAATCCCAGCAGAGAGTGACCGTGGAAGATGGGT
TCAGTCCCCGCCGTATCTGTGCTTATTCTGGCGATCGCTG
TTCCGAGTCTAGCCGGATACATTGAGGCGCTGGCAGCAAA
TGCAGGAACCGGATTTGCCGTCGCGGAGCCCCAGGTTGCC
ATGTTCTGTGGCAAACTCAACATGCACATCAACATCCAGA
CTGGCCGCTGGGAACCAGACCCTTCTGGATCTAAAACCTG
CGTTGGAACCAAAGAAGGAGTGCTGCAGTACTGTCAGGAG
ATCTATCCCGAGCTGCAGATCACCAACGTGGTGGAGGCCA
ACCAGCCTGTCAAGATCGAGAACTGGTGCAAGAAGGACAA
GAAGCAGTGCAAGGGCCACGCTCACATTGTGGTGCCTTAC
AAGTGCTTGGTTGGGGAATTTGTAAGCGACGTCCTGCTGG
TGCCAGAGAAGTGTAAATTCTTCCATAAGGAGCGCATGGA
CATGTGTGTCAGTCATCAGCAGTGGCACGGCGTGGCCAAA
GAGGCCTGCTCCAAGGGAAACATGGTCCTGCACAGTTATG
GCATGCTGCTGCCCTGTGGCATCGATAAGTTCCACGGCAC
TGAATACGTCTGCTGCCCGTCCACGCGTCCCGAAGAGCCC
GCACCTCCAGCGTCACCTTCTAAAGAGATGGATGATGAAG
ATGATGATGATGAGGAGGAGGAGGATGTGGAGGAGCCTGT
GGTTGAGGAGGACGAGGAAGATGATGAGGACGCTGTAGAT
GAGAGTGAGCCTGTTGCCATCGATCCTCCCACTCAGGAAG
ACACAGCAGAGGAAGAGGAGGAGCAGGAGGAGGATGGAGA
TGAAGAGGACTATCACTACATCTACGAGGATGAGGAGGAG
GACAGAGACAGCGAGGAGAAGGATGTTAAGAAAGAGAAAG
CTGTCATGCCGGAGAAACAGGACGATGACAAAACTCTGCA
GGAAGTAGAAGCTGTGTGTTCTCTGGAGGCGGAGACCGGC
CCCTGCCGCGCCTCTATGCCTCGCTGGCACTTCGACATGC
AGCAGAGGAAGTGTGTGCGCTTCATCTACGGAGGCTGCGC
CGGCAACCGCAACAATTTCGACTCAGAGGAGTACTGCATG
GTCGTGTGCAAGCGCCTGACCGTCCCGCCGACCCCTCAGC
CCACAGATGATGTGGATGTGTACTTCGAGACCCCAGCAGA
TGATAAAGAGCACAGCCGCTTCCAGAAAGCCAAGGAGCAA
CTCGAGATCAGACACCGCAACCGTATGGAGAGGGTGAGGA
AGGAATGGGAGGAGGCCGAGAGCCAGGCCAGAAACCTACC
CAAAGCTGAGAGACAGACATTGATCCAGCACTTCCAGGCC
ATGGTGGAGTCTCTGGAGGAGGAGGCAGCCAGTGAGAAGC
AGCAGCTGGTGGAGACTCATCTCGCCCGGGTGGAGGCCAT
GCTGAACGACCGCCGCCGCCTCGCCCTGGAGAACTACCTG
GCCGCTCTGCAGGCTGACCCACCACGACCTCATCGTATCC
TGCAGGCCCTGAAGAGATACGTGCGTGCAGAGAATAAGGA
TCGTCAGCACACTATCCGCCACTACCAGCACGTCCTGGCT
GTGGACCCAGAGAAGGCTGCCCAGATGAAGTCCCAAGTGA
TGACGCATCTGAGGGTGATCGAGGAGAGGATGAACCAGAG
CCTGTCTCTGCTCTACAAGGTGCCGTATGTTGCAGAGGAG
ATCCAGGATGAGATTGATGAGCTTCTGCAGGTCCAAAAGG
CAGATATGGACCAGTTCCTGTCCTCCATCTCTGAGTCCCA
GCCTGACGTCACCGTGTCTTCTGAGGAAAGTGTTGAGGTT
CCTGCTTTTGAAGGAAAGCCCTTCCGCCCCTTCCAGGTCA
ACTCTCTGGGCTCCCCCGCTGAACCAGAGGGCTCTGGCAT
GAACAGTCTGGATGGTCTGATTGGAGCAGAGGAAAAAGTC
ATCAACAGCAAGAACAAGATCAACGAAAATGTGGTGATTG
ATGAGACTCTGGATGTTAAAGAAGTGATTTTGAATGGTGT
TGATCCTCTGTTCAGCCGTGGCTCGGAGCAGGAGTCATTC
CGCCCTCTGGTGGACGATTTCAGCTTCGGCAGCAGTGCTC
TGATCGGCCTGCTGGTGATCGCTGTAGCCATCGCCACCGT
CATCGTCATCAGTCTGGTGCTGCTGAGGAAGAGGCAGTAC
GGCACCATCAGTCACGGCATCGTGGAGGTTGATCCCATGC
TCACTCCAGAAGAACGTCACCTGAGCAAGATGCAGAACCA
CGGCTATGAAAACCCCACTTACAAATACCTGGAGCAGATG
CAGATTTAGCCATCATGCGGCGCTGTGGAGCTGAGAGGGG
TGAACATACTACTGACCAATATAAAACTGCTCTCAAATCA
TTTCATGCATTTGAAATGCATATCCTGGTTCATTTAAAGA
AAAAAAAACTACAACAACACAATGGGTTATTAATACTACT
ACTTCTAATACTGCTACTGTTGTACCATGGAGCGCAATTT
TTAGGCTCTTGTAACTTTTTATTTTCGTTAAAAAGCAACG
GTTTTAAATCAGGAGAACGTGATTCTGCAAATTGATTTTG
GAATTGGAGCGTATTATTATTTTAATATGGTTTTAAATGT
TCATTTGATAACGTTTGATTTTAGTATATAGAGGTACAGC
AAAGCAAAGGCGAAACAATCAATATATAAAGACACACAGC
AGTTTGTCTACACCATCGCTGGCCGCCGGATATACTTCTT
TTAAATAGATCGCTTGTATATGAAGGTTATTTGTAACAAC
TTAAATGTATAGTGAATCAGAAAATATGAACAAGAAATCA
TTAATTCATTTACTTTGTAATTATTAAAGACACACGATAT
ACATAAATAGAGAAAGTAGATGGTCAATTTAATTCATAGT
CATATTCATGATTTTTACGATATATATCTATATATTTTTT
TTCTCTCCAGAGCTTAAATCTTGGCTGGGTTACAGGTTTA
AACTTTTGAGATTTAAAGGACGGATTTTTTTTTTTTTTAC
GGTCCAAACATCTGATACCGTCGCCTGTGTAAGATACGAA
GAACGGTTCCAACAGAACGGCGTGACAGCCGGCCAGATAT
TTTGGCCGATTGCGAATGTAGAGGTGCCCGATTTTCGTAA
CATTACGTCATGTGTTGTTATCTTTTGGTTATGGTGTCAT
ATAGTTGGACCAATAAATGGCGCGGCCCCTGCGAATGGTT
ATTGTGCATTGGTTTGAAGCAGCGAGCGGGTCAGGGGCCT
CCAGTCTCCCATATCACGCGAAAATATTGTTTTACTCTGA
TTCTGAATGTTGTTTCTCACGCCGTTACTTGATCTGGCCT
GATAAAATGTTGCATTCAGCTTGAGTTTATCACTGCATTT
TCATTTCATAGCTATTAGGGAGATTTGTCTTGTGGCAATA
CTTTGCGTATATCAAAGAAGTGTAGATAGCGACCAGAGTC
GTCTGTAATTAAAGAAACACGTTGTTGTTTTTTTGGAAAT
AGGCTCATTTTACAACTCCTCTAAAGGTAAACAGTTTAGT
TTTACCATGTTTGAATGCATTCAGTCAATCTCCAGCTCTG
ACCGGAGCACTTTTAGCTTAGCTTAGCATAAATCATTGAA
TCGGATTAGACCATTAGCATCTTGCTCAAATTTTTTTTTT
GTTTTAAAGAGTTTTAATACTTTACTATTTAAAGATTGAC
TGTTTTTTAGTTACATTGTGTACTAAGACTGACAGAATAT
AAAAATGTGCTATTTTCTTGGCAGATATGAATAGGCAGTT
CACTCAGTCAGGCGTAATAATCAAGAAATGTTGCTGTTGT
GCTATGGCTGCAGCAGTTTAATGATATTACACAATGTAAC
TACACAAGAGTCAAACTTTAAATAGGAAAACTATTGAAAC
TCTTTTATTTTTGAATGAGATGCTAATGGTCTAATTCGGT
TCAATTCTTTATGCTAAGTTAAGCTAAAAGTGCTCCCTCC
TGACCCGGAGGTTGACTGAAGGAATTAAAAATTGGTCAAA
CTGAACTATTTAATTCTTTTTGGAAATAGGCTCATTTTAC
AACTCCCCTAGAGCTAAAAGTTTTACCATATTTTATTGCG
TTCAGTCAATCTTTGGGTCTGGCAGGAACACTTTAAGCTT
AGCTTAGCATAAATCATTCATTCGGATTAGACCATTAGCA
TCTTACTCATTTTTTTTTGTTTGTTTTAAAGAGTTTTGAT
AACTTTACTATTTAAAACTTGACTCTTCTTTAGTAACATT
GTGTACTAAGACAGACAGAAAATTAAAATATGCAATTTTC
TAGGCGGATATGGTTAGAAATTCTACTCATTCAGGCATAA
TAATCGAGAAACTTTGCTGCTGTACAGTGGCTGCAGACAT
GCGATGATATTACACAATGTAACTACTGGAGAGTTAACTT
TAAGTAGGAAAATTATTGAAATATATATAATTTTTTATTT
ATTTTTCGAATGAGATGCTAATGGTCTAATTTGATTCAAT
GATTTATGCTAAGCTAAGCTAAAAGTGCTCCCGCCTGACC
TGGAGCAGAAACTGGCTGAATTAATTAAAGTATGGTAGAA
CTCAACTCTTTTACACTATGTAACTTGTAAAATGAGACTG
TTTCCCCCCAAAAAGTGGAGCGTTTCTTTAAAACACTATG
AAATGTAAAGTTTCTAGCATCAGTCCCGCACAGAAAATCA
TGCTAAGATGCACTAAAGTTACCCAGCTGGAGGCCAACGA
ATGCGAGAGATGTTTTGCATGTCTGCTACTACTATGGAAG
GCAAGGAAAAATTTAAATTTTTTTTTTTTTCTATCTCTTA
CCCTTCTTCTTAGCAGTGTCTTTGTATGCCTGTATAGTCG
ATGTTGCAATCATGGCTTTTATCAAGGACAACCTGTGGTG
TGCATTGTTCTTATATGAGATGTTATGATATATATTTTTA
AGTTTGTTCTCTTCTTCTTTGATTTTTCTATTCTTTTTTC
CCTCTTCCTGTGACAGTATTTCTGTATGTGACTTTCACTA
TGCACCTAAACGGCTCCAGTCTTGGACCTTGTCATTGCCT
GCTTGATTGTGAGATGGTCATGGGGTGAGGGGAAACCATA
CAAAGTTCATATATATTAGAAGTAAACAATGAGTGAATCC
AATGGAAAATGGCTTCTTGGTTACAGGTGGGAAACACATC
AATAAATTCACTACTTCCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aplp2-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000023553 (1),  Ensembl_Trans:ENSDART00000077125 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC160603 (1) 5427 bp
GenBank:CN838879 (1) 848 bp
GenBank:CK145477 (1) 813 bp
GenBank:CT679085 (1) 760 bp
GenBank:BM141507 (1) 742 bp
GenBank:CK237491 (1) 716 bp
GenBank:CT608123 (1) 680 bp
GenBank:BI672476 (1) 630 bp
GenBank:EB928209 (1) 606 bp
GenBank:EB918354 (1) 605 bp
GenBank:AL916878 (1) 539 bp
GenBank:BI673012 (1) 513 bp
CITATIONS (2)