ZFIN ID: ZDB-TSCRIPT-090929-657
Transcript Name: ephx1-201
Previous Name: ephx1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006181 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006181|OTTDARG00000005675|ZDB-GENE-040426-913 ephx1|OTTDARP00000005496 ephx1-001 LG_ BX255939.3 Danio rerio protein_coding KNOWN, 2325 bp
CTTAAAGCCGTTAAATTCATTCAAATCACAGCATGATATG
AGAAGTTCGCTTCGTGTGCAGTTGTTACTATAATTTTCCC
TTAATTGTCATAAAAACAAAAAACACCACTATTGAGTTAC
ATAAAACGTAATATGAGCTGCATTTTTATGTAATGAAAGG
AGTCTGCGCAGCGACCTGTCTGACTGCATTTCCCGTGGTG
CACTGGGCTCATGTTACTGCATCTTGGTGCTAAATGAACG
CAGCATTTTATCTTGCTACTTTTTGAGATCCATAAACTAT
GTACCTAGAGGTGATAGTGGCATTGGGGCTCGGATTGGTG
GTCGCTCTGATATTTCTAAAAAAGAGAAAGACTGTCCTGA
AAGTGCAGGATGGGTGGTGGGGTATGGGAACTTGTCCCCA
AGGACCTGAGGATGACAGTATCCGGCCATTTAAAGTTGAG
ACGACTCCTGAAGAGATTGAGGATCTACACCGTAGGCTAG
ACCAGACCCGCTCCTTTCCTTCTCTTGAAGACAGCCAGTT
CAACTACGGCTTCAACTCCAAATACCTTGAGAAGGTTGTG
TCTTACTGGAGGAAGGACTTTAATTGGGGAAAACAACTGG
ATAAACTGAACAAATATCCTCATTTCAAAACCAAAATCGA
AGGCATTGATATTCACTATGTTCACGTGAAACCGAAGAAC
CTGCCAGAGGGAACCCGCGCTGTACCACTGATGATGGTTC
ACGGATGGCCTGGCTCTTTTTATGAGTTTTACGGCATCAT
CCCCCTGCTCACAGAGCCATCTAATCCAGATGACATAACC
TTTGAAGTCATTTGCCCCTCGATACCTGGTTACGGCTTTT
CAGAAGCATCACACAAGAAAGGTTTTGACACAGTGTGTGC
TGCTCATATATTCAATAAACTGATGAAGCGCCTTGGATTC
ACCCAGTACTATGTTCAGGGAGGAGATTGGGGGTCCATGA
TTACCACGAATATGGCTCAGTTGGAGCCCAATGCTGTAAA
AGGTCTCCACATTAACTTCGCTCCCCCTGCACAAGGCAGT
GTTCTTATGGGCTTATCTTTAATTTTCGGCCGTCGATTCC
CCAAACTCTTTGGCTTCACCGAGCATGATGTGAAACGTCT
ATTCCCCTGCATGGACAAGCTTGTAGTGGATGCTTTGAGG
GAGACTGGATACATGCACATACAGGCCACTAAACCTGACA
CTGCAGGCCGTGGGTTGAATGACTCCCCTGTTGGTTTGGC
TGCTTACATTTTGGAGAAATTCTCAACCTGGACTGACCCT
GAATTTAGGAAGCTTGAGGACGGTGGACTGGAGAGGAAGT
ATTCTCTTGATGATCTTCTGACGAATGTGATGATCTACTG
GACTTCTGGATGCATTATATCCTCCATGCGTTTCTACAAG
GAGAACTTTGGCAAAGGCCTGAACCAGCCTCATGCAAAGC
TTCCGGTTCACGTTCCGACAGGTGTGGCTTCTTTCCCTAA
TGAGCTTTTGCACACCCCGAAACTGTGGGTAACAGACAAA
TACCGTAACCTCAAGTCTTACACACCCATTGCTCGTGGAG
GCCATTTTGCAGCTATGGAGGAACCACAGTTACTGGCTGA
AGATGTGCAGAACTTTGTCAAGATTGTAGAGAACAGGAAG
CGGAAATGATCCATTCTAATTCACACTCATGGGACTCTAA
TAAACGCATTTATAAAGTGATTACCATGTAGGAAAAACAC
AATCCTCACTACAAATACATACTGTAATCTGCATTGTCAA
AGCTCTTATAAAGAAATGCATTCGCACTGCTAGGAATATA
TAACAATTGTGCTTTAAAGGGATAGTTCACCCTTCAAAAA
TGTTTTAAACTGGCATAATTTTTCCCTCTTCACATGTTCC
AAACCTCATACAGGTTATTTCATCTGCTGAAAACAAGAGA
CAAGATATTCTAAAGAACAAACTAAACCAAAATCATTGCT
TCCATAGTAAGCCATTGGGACCAACAATGATTTTGGTGAA
CTCTACTATGGTAGTCAATGGGGACCATCAACTTTTGGTC
ACCAACATATCTTTTGATTCTGCTCAAAAGAAGATATTTT
GAAGAACGTTGGTAAACAAAAATTGGACTTCCATAGTAAG
CCAATCGCAATTTTGGAAAAACTTGTGTAAATAAATAATA
ACAGAAATGTCATTTTTGGGTGAGCTGTCCCTTTAAGAGG
AATTGTGCTTCACATGATTATAAATTGACAGACGCTTGCT
TGTGAAATATTTCAGAGTGATTTGATGCTGATGTGTTTAA
ACGCGATCAATACAGTTCAAGATATTAAACAATATGAAAT
TTAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ephx1-201 Contained in:
[BAC] DKEY-5G7 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000006181 (1),  Ensembl_Trans:ENSDART00000062898 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC045930 (1) 2121 nt
GenBank:BC165341 (1) 1438 nt
GenBank:EH485954 (1) 1015 nt
GenBank:EB969245 (1) 373 nt
CITATIONS (2)