Transcript

ephx1-201

ID
ZDB-TSCRIPT-090929-657
Name
ephx1-201
Previous Names
  • ephx1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000006181 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000006181|OTTDARG00000005675|ZDB-GENE-040426-913 ephx1|OTTDARP00000005496 ephx1-001 LG_ BX255939.3 Danio rerio protein_coding KNOWN, 2325 bp
CTTAAAGCCGTTAAATTCATTCAAATCACAGCATGATATG
AGAAGTTCGCTTCGTGTGCAGTTGTTACTATAATTTTCCC
TTAATTGTCATAAAAACAAAAAACACCACTATTGAGTTAC
ATAAAACGTAATATGAGCTGCATTTTTATGTAATGAAAGG
AGTCTGCGCAGCGACCTGTCTGACTGCATTTCCCGTGGTG
CACTGGGCTCATGTTACTGCATCTTGGTGCTAAATGAACG
CAGCATTTTATCTTGCTACTTTTTGAGATCCATAAACTAT
GTACCTAGAGGTGATAGTGGCATTGGGGCTCGGATTGGTG
GTCGCTCTGATATTTCTAAAAAAGAGAAAGACTGTCCTGA
AAGTGCAGGATGGGTGGTGGGGTATGGGAACTTGTCCCCA
AGGACCTGAGGATGACAGTATCCGGCCATTTAAAGTTGAG
ACGACTCCTGAAGAGATTGAGGATCTACACCGTAGGCTAG
ACCAGACCCGCTCCTTTCCTTCTCTTGAAGACAGCCAGTT
CAACTACGGCTTCAACTCCAAATACCTTGAGAAGGTTGTG
TCTTACTGGAGGAAGGACTTTAATTGGGGAAAACAACTGG
ATAAACTGAACAAATATCCTCATTTCAAAACCAAAATCGA
AGGCATTGATATTCACTATGTTCACGTGAAACCGAAGAAC
CTGCCAGAGGGAACCCGCGCTGTACCACTGATGATGGTTC
ACGGATGGCCTGGCTCTTTTTATGAGTTTTACGGCATCAT
CCCCCTGCTCACAGAGCCATCTAATCCAGATGACATAACC
TTTGAAGTCATTTGCCCCTCGATACCTGGTTACGGCTTTT
CAGAAGCATCACACAAGAAAGGTTTTGACACAGTGTGTGC
TGCTCATATATTCAATAAACTGATGAAGCGCCTTGGATTC
ACCCAGTACTATGTTCAGGGAGGAGATTGGGGGTCCATGA
TTACCACGAATATGGCTCAGTTGGAGCCCAATGCTGTAAA
AGGTCTCCACATTAACTTCGCTCCCCCTGCACAAGGCAGT
GTTCTTATGGGCTTATCTTTAATTTTCGGCCGTCGATTCC
CCAAACTCTTTGGCTTCACCGAGCATGATGTGAAACGTCT
ATTCCCCTGCATGGACAAGCTTGTAGTGGATGCTTTGAGG
GAGACTGGATACATGCACATACAGGCCACTAAACCTGACA
CTGCAGGCCGTGGGTTGAATGACTCCCCTGTTGGTTTGGC
TGCTTACATTTTGGAGAAATTCTCAACCTGGACTGACCCT
GAATTTAGGAAGCTTGAGGACGGTGGACTGGAGAGGAAGT
ATTCTCTTGATGATCTTCTGACGAATGTGATGATCTACTG
GACTTCTGGATGCATTATATCCTCCATGCGTTTCTACAAG
GAGAACTTTGGCAAAGGCCTGAACCAGCCTCATGCAAAGC
TTCCGGTTCACGTTCCGACAGGTGTGGCTTCTTTCCCTAA
TGAGCTTTTGCACACCCCGAAACTGTGGGTAACAGACAAA
TACCGTAACCTCAAGTCTTACACACCCATTGCTCGTGGAG
GCCATTTTGCAGCTATGGAGGAACCACAGTTACTGGCTGA
AGATGTGCAGAACTTTGTCAAGATTGTAGAGAACAGGAAG
CGGAAATGATCCATTCTAATTCACACTCATGGGACTCTAA
TAAACGCATTTATAAAGTGATTACCATGTAGGAAAAACAC
AATCCTCACTACAAATACATACTGTAATCTGCATTGTCAA
AGCTCTTATAAAGAAATGCATTCGCACTGCTAGGAATATA
TAACAATTGTGCTTTAAAGGGATAGTTCACCCTTCAAAAA
TGTTTTAAACTGGCATAATTTTTCCCTCTTCACATGTTCC
AAACCTCATACAGGTTATTTCATCTGCTGAAAACAAGAGA
CAAGATATTCTAAAGAACAAACTAAACCAAAATCATTGCT
TCCATAGTAAGCCATTGGGACCAACAATGATTTTGGTGAA
CTCTACTATGGTAGTCAATGGGGACCATCAACTTTTGGTC
ACCAACATATCTTTTGATTCTGCTCAAAAGAAGATATTTT
GAAGAACGTTGGTAAACAAAAATTGGACTTCCATAGTAAG
CCAATCGCAATTTTGGAAAAACTTGTGTAAATAAATAATA
ACAGAAATGTCATTTTTGGGTGAGCTGTCCCTTTAAGAGG
AATTGTGCTTCACATGATTATAAATTGACAGACGCTTGCT
TGTGAAATATTTCAGAGTGATTTGATGCTGATGTGTTTAA
ACGCGATCAATACAGTTCAAGATATTAAACAATATGAAAT
TTAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations