Transcript

chp1-201

ID
ZDB-TSCRIPT-090929-6550
Name
chp1-201
Previous Names
  • chp-001
  • chp1-001
  • zgc:63904-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023476 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023476|OTTDARG00000019178|ZDB-GENE-030131-4086 chp1|OTTDARP00000019507 DKEY-41N20.1-001 LG_ CR376783.22 Danio rerio protein_coding KNOWN, 1634 bp
CCCATATCGACCTCCCTTTAGCTTAGCCTCACAAACTCTT
CCTATATTCTGTCAGATTTCTCCGGGTTCGTGTCTAAACT
GCTTTGTAATCTATAAACAGGCCGGTTTTTACGCCGGACC
GACCGTTGGAAAAGCTGACCATTCATCCGACAGCTTTTTA
GAGCTCCGTGTTCAATCATAAGAAGTGTATATCATATGTT
AGCTTGAGCAGTCTGATCTGATCTTCAGCAGTCATGGGCT
CCAGAGCTTCGTCTTTACTCAGAGAAGAGGACATTGAAGA
GATTAAGAAAGAAACTGGATTCTCTCACAGTCAGATCACT
CGCCTCTACAGCCGCTTTCACAGTTTGGACAAAGGAGAAA
ACGGAGGACTCAGCCGTGAAGACTTCCAGAGGATTCCTGA
GTTGGCTATAAATCCTCTCGGTGATCGGATAATTAATGCC
TTCTTCCCAGAGGGTGAGGATCAGGTGAACTTCAGAGGCT
TCATGAGGACTCTGGCTCATTTCCGGCCTGTGGAGGACAA
TGAGAAGAACAAAGACCTGACAGGAGAGCCGCTCAACAGC
AGAACCAACAAACTGCTCTTTGCATTCCGGTTATATGACC
TCGACAGAGATGACAAGATCTCCAGAGATGAGCTGCTCCA
GGTGCTGAGGATGATGGTAGGAGTGAACATTTCAGATGAG
CAGTTGGGAAGCATCGCAGACAGAACAATCCAGGAGGCAG
ACACTAATGGAGACATGTGCATCTCCTTCAACGAGTTCAC
CAAGGTATTGGAAAAAGTGGATGTCGAACAAAAGATGAGC
ATCCGTTTCCTTCACTGAAGACCAAACACATTCTGAACTC
TGATTGGAGCCCGTCTGTGACATCATAGATAAGACACGCC
CCCTGGTTCTCCTCTGTGTGAGCTGATTCGCCTTCGATCA
ACATTTGCTCCAGTCATCTGTCACTCTTGAGTTGCTGGTG
CACTAGACGGACGCAACGTCCAGGTGCCTTCAATACTCTT
ATAAATGACAATTCTCTATTTATTATTAACAGTTTCAAAG
CTTTCCAAATGGCTGAATCTTGTCGTTTAAATTGACACTG
ACAGAATCCTTTTGTCATGATTTCATCACAATCTCTGAGG
CCAAATCTGATGTTCCCTTTTCACCCATGAAAATATTTAA
CTTATGCCACATTCACTCAAAAATACCTCATCATTCTTCT
TTTATTTCCTCATAAGGGCGGACACTTTTTTTTTCTGTCT
CGTAATAAATAATGATTTGTAAGTCATCGCTTGGGAGGGA
GTGAAATACAGATGAATCCACTACATAAGACACATTCAAT
AGGGTTTTCTCTTTAAATGTCTTATAAACTGTGAACTAGA
TCAGCTTCAGTGCTTCCCACAGGTTTTAAATATACTTGTG
GTGGTAGCCGTATTGAAAAACTTTTTACCCACATCACATT
AATAGTTATCTACAGTTGAAGTCCGAATTATTAGCCTCCC
TTTAATTTTTTTTTTTATTTTAAATATTTCCCAAATGATT
TTTAACAGAGCAAGGACATTTTTTTTCTTTTGGGGAAAGT
TTTGTTTGTTTTATTTCGGCTAAAATAAAAGCCTTTAATT
TAAAAAAAAAAAAAAAACATTTTAAAGTAAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations