ZFIN ID: ZDB-TSCRIPT-090929-652
Transcript Name: ncoa1-202
Previous Names: ncoa1-002, ottdart00000006175

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000006175 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000006175|OTTDARG00000005670|ZDB-GENE-041001-175 ncoa1|OTTDARP00000005492 ncoa1-001 LG_none BX255939.3,BX248390.7 Danio rerio protein_coding KNOWN, 5926 bp
CACCTTCTGAGTGACGTGAGCGATCCTCCTGTTTGTTTGT
GTAGCTCGAGGATGAAAATGGCGGTGGCGAGAGATCAACG
CGAGAATTAAACACACAAATGACCATTTGACGTGGATGAC
AGCGGCACTGCAGCTCCGCGAGCGACTAAAGAAGCGTCTC
ATCGTCACGCGAGTGCATTCACGACAGCAAACACCCGGAG
TTTAACGAGAAGAAACTGCGTCCTGGATTTAAAATAGCTG
CTGAAATTAGCCCGCTAACCTCGTTAGCTTAGCTAGCCTT
CAACCGAAGGGTTTAACGGACACCACAGCACAACACTAAC
GGAATTATTCTGCCAGAATAAGATGAACTGCGCATTTCTC
GACTTACCTCTCATATGCAAGCTCAGCCGCTGGCGCTGGG
CTTGCAGAAATGTTTGCATCTGACTGAATGCATAACTAAT
CGCTCCATCTGGCTGTATTAGCCAGCAAACAACATCCAGC
ATTCTCAAAGTTCACAGAGCATCTGTAAGAGGAGATCGGA
CTAAACAGGTTGGATTGAGCGCCCTTTACCTTCCTCCCTC
CCCTAGTGGGATGGTTCTGCATGACAGGGAGGGTATGGTT
CTCTAACCTCCCTCTCTGTCCTCCAGGTCCCATCCTGTAA
ACCCAGTAGACCACAGCCATAGTGATCTCCTCAATGAACA
TCCTTCAAGAGCTCTAGATCAATTGCCATTGGTCATCCAT
TTAGTGCTGCCTCCCCCCGGTGGGATGGTTCTGCATAACA
GGGAGGGTGTGGCGCCGTAGCCCCCTCTCTTTGACATCTC
TCCCGCCTCATAAACCCAGTGGACCACAGCCATAGTGTCC
CCTTCAATGAACATCCCTTTGGAGCCCTAGACAAAGTGCG
CAAATGCTCAAAATGAGTGCCGCCGGGGAGAATGCACTCG
ACCCCAACATCTTAGAGTCACGGAAGAGGAAGGGCTCTCC
ATGTGATACCTCTGGTCCCAGTGTGGAGAAGCGGCGGCGG
GAGCTGGAGTGCCGCTACATTGATGAACTGGCTGAGTTAC
TGTCGGCCAACATGAGCGACATTGCCAGCTTGAACGTGAA
GCCGGACAAATGCCACATCTTAAAAAGCACCGTGGACCAG
ATCCAGCAGATCAAACGGCGCGAGCAGGAAAATGCAGCTC
TGATGTCTCCAAATGATGAGGTGCAGCAGAGTGACATATC
GTCCAGCAGTCATGGCATGGTGGAAAAGGAAGCTCTTGGG
CCTCTTCTCTTAGAGGCCCTGGATGGCTTCTTTTTCGTCG
TGAACCGTGAGGGCCGCATTGTGTTTGTCTCTGAGAACGT
CACCGGTTATCTGGGTTATACCCAGGAAGAGTTGATGACC
TCCAGCGTCTACAGCATCCTTCATGTGGGAGATCACAACG
AGTTTGTGCGCATTCTGCTGCCCAAGAGCCTTGTAAATGG
TGTGCCATGGTCTCAGGAGCAAGGCCGGAGGAACAGCCAC
ACGTTTAACTGCAGGTTGCTGAAAAGGCCTCCAGACGAGG
TGGACTCAGAGAACCAGGAGGCCCGACAACAGTATGAGCT
CATGCAGTGCTTCACAGTCTCTCAGCCCAAAGCGCTGCAG
GAAGAGGGCGAAGACCTGCAGAGCTGTTTGATCTGTATAG
CATGTCAAATACCCCGTCCACCTCAAATCCCTGTTAGTAC
AGAGTCCTTCATCACCAAGCAGGACCCTACAGGGAAAATC
ATCTCTATTGAGACGAGTGCTCTGAGGGCCACAGGCCGAC
CAGGTTGGGAGGATCTGGTCAGGAAGTGCATCTATGCTTT
CTTCCAGCCTCAGGGCAATGAGCCCTCCCATGCCAAGAAG
CTGCTTCATGAGGTGATGACCCACGGCATGGCCATCAGTC
CTCTCTACCATTTCACACTCAGTGACGGGACGTCCCTCAG
TGCGCAGACGCGCTGCAAATTCTGCTGCCCCCAAAACCCA
GACGTACAGCCCTTCATCATGGGCTTTCACACTATAGACA
GGGAACACAACACTGCTAGCTCTCAGGAAAACACTACCCC
CAGCCTTTCGTCTCCTGCTGCTCCCCCTTCCCGCTCGCCT
GCCCTGCAACCCTCCAGTGACCTCAGCATCCATCTCAACA
ACACCAACGGCACCTGTGCCACTCCCGGCCCCCTCACGCC
CACTCCACCAGGCTACCTGACGCCCAGCCGCGTCGGGCCG
TCACAGCAGGTCAGCAGCCCCTCTCCACTAGGCAGCCCTC
TTACAGCAACCCCTACCTCATTCATGTCGCCCCGACCTCC
ACGGGGCAGCCCGGGCCTGGCCAGCAGCCCACGAGTGCCC
GGACATCCATTCTCCCCCTCAACGCCCAGCATCCACTCGC
CAGCTGGTGGACTAACCAGGCAGCAATCTGGCGGCGATGG
TGTTGGTTTCTCGCTCCCTTCTCCTTTGCCCCCCAGACAG
ACTCCAACTCCCAGCAGCTCGCCGGCAAGGCAGCCTCCTG
CCAAACCGCCAGAAGCATCCAACGATGAGCCTAAAAGCAA
TCAAGTCGGCAACCCCAAGCTCAGCCAGCTTTTAGATGGC
GCAAGCGCCCCCGAACAAGACTCACAACCCCGTCCTTCAC
CCACGTCCCAATGCCCGGCCTCGCACAGCAGCCTGACAGA
GCGGCATAAGATTCTGCATCGGCTGCTTCAGGACAATAGC
CCTGCAGATGCGGGCAAGGAGCCGGATATTAAGAAGGAGC
CCCCGACCAGTCCCAACTCAGCCTTGATAGCACGGGGACT
CGGGAAGGAGCCCCAGGACCACCAGCTGCTACGTTTCCTG
CTGGATACGGATGAAAAAGACCTGGAGGACTTGCCACCTC
CGGCCACCCTCAGCCTTCAGACGGTAAAGGTGAAAGCTGA
GAAGAAAGGAAGCAGAGAGAATGTGTCCTGTGCTGCTGCT
TTGGCCAACAATGCCATGCCTGGCTCACCTCAATCCAGTG
GCAAGGCCAGCCCGCAGTTTCCCAGTACCGATCTGGACAC
TTTAAACCAGCTCTTGCCCACTCTGAGAGCCTCTGTTGGA
GGTAAAACAGTAGAGGAACCCAGTGAGGACAGCCTTTCCA
TCGGGGTCAATGTGAAGAGAGAGTCACCTGGAACATCAAG
CCAAGCATTCCCTGATGGAGAAAACCTCTCAAGTCAGACC
TCTTTTGACTTTTGTGACCCATCCACACCAAACCAGGGTC
AGAGTCAAGTCCAGGTGTCGGATCTTGGCCAGACAGAGCT
GTTTCAGCCACCTAAGGAGAGCAGCAGCCCCTTTGCCAGT
CCAACAAGCCACAACTCTTTTAACACTAACACAGGTCTGG
CCAAACTGGAGCTTCCAGATTCTCAGCAGTTCCAGGCTTT
GCCTCTGGTTGAACCAATGACCTTTGATAACAGTTTGGCC
AACCAGACACAGGCCCCTCTGTCCTCTCCTCAAGAGCAGT
GTGTCCCGTGTCCGCTGGATGAGATGCTGTGTCCTCCCAC
CACCCCAGAGGGACGAAACGACGAGAAGGCCCTGCTGGAG
CAACTGGTCACTTTCTTGAGCCACACTGACGAGAGCGAGC
TGGCAGAGCTGGACCGAGCGCTGGGCATCGATAAGATTGT
TCAAAGTGGATGCCTTGAACCAGTCACCCAGACCCCCTTT
CCTCAATCTCAGCCCCCAACACCTGTACCCTTGGACCCCA
AACTGCCCAGCTACCCCTCTCAGTTCCCCACCTCGCCCTC
ACAGTTTCCTGCTGAGATGGCCACCGCACAGGGCATGAGC
TTTGGGGCCCCACGGATGCCGTTTCCAGGCAACGTGGTGC
AGGCCGGCATGAACCGAGCTCCCGGTGTGTCCAACCAGCT
CCGGCTACCTCCAAACCAGCTGAGACTCCAGCTCCAGCAA
CGCCTGCAAGGGCCACAGCAGCTCCAGAACAGGCTGGCAG
CCATGGGCTCCTTCCCCCAGGGGGGGCATGTTGCCATGGG
GATGCGTCAGAGCATTCAGCAGCCTCAGATGCCCTCTCAG
CCTCCGCTGAATGCTCAAATGATGGCCCAGCGGCAGCGTG
AGGTCTACAGTTACCAGCACCGCCAGCGGCAGCTTCTGCA
GCAAAAGGTCATGCTAATGAGGCAGGGAATAAACACAGGG
CCCCTGGGGGCTCAGAGACTTCCTAAGGGCCCCCAGCAGC
AGCAGCAGCCGCCACCGCAGCAGCAGCAGCAATTTGGCTT
TCCTCCAGGATACAACGCTGTGCCTGGAAACACCCCTACC
TCCCCGAGCCACTTTAACCCCATGGGAGGACCTCTGGACC
CAAAGCTGTCCGTCAGGGCAGGCCTGGGGAACCAAGGCAT
TATGGGAGCCATTCAAGGGCAGTTTGGGGGGCCTGTGAAC
ACTCCTGTTCAACAGGGGCTTTTCCAGCAATTTGGGGGGT
CTGGCATGATTCAGCAAGCAGATCCATCGTTTGCTCCTGA
GCTCAGCCCCACCAGCCCCCTGCTCTCACCTCAGAACTCC
ACCTCCCAGAGTCCTCTGCTCCAGCAGACACAGCCTCCGC
CTGGTTACCAGTCACCTGACCTCAAGACCTGGCAGCAGGG
AACTGTGGCAAACAACGGTATGTACAACCAGGTGGGTCCG
CCAGTCTCTCAGAGCTTTGGGCAGCAGGGCGTTTATAACA
ACATGAGCATCACCGTGTCAATGGCCGGAGGCTCTGGAGC
AGTGAACACTCTACCTCCTATTGGTCCATCCGTCGGCATG
GGCAACAATAACCTTGGCAACGTCACCACAATGTGTAATG
AGCAGGTACAGCAGGTTCAGGTGTTCGCTGATGTCCAGTG
CACGGTAAACCTAGTGGGCAGTGACTCCTACCTTAACCAG
TCGGGGCCTATCGGATCCCAAAAGGGCCCGAGCGGAACCC
CCAGTGCCCAGTCCCAGCAGAAAAGCCTCCTCCAACAGCT
CCTGACCGAGTGAGAGCCGCCACCATCCACCAGAGGGACA
GTCAGTCTCCACATGTAGAGATTTTTATCCTTCACCTTTG
GTTTCTATACAGTATATCTGCAGGGTCGGTGTCTGGGGCC
CAGGCTTGAGAGGTTTCATAGCTGTTCGACAAAGTGCTCA
TTCCTGGTCACCTTATAAAGCGTCAGTTTCCGGAAAAGGA
GAAACAAAAAGAGATCACGTTCCAGAATTTGCCAAGTCTG
TATAAAAACAAACAAAAAAAGAGTAATTAAAAACACGGAC
CTGCTGCTTCAGCCGGCTACACGTCCTGTCGGTCAGGCCA
ACGTTGCAGTGCTTCTTGGAGAGCGGCGCAGCAGCTGAGC
TCGGATTGGAAACTAGGGCGGGCCGTTGCCATGCTGTTGC
TAAGTTCATGGAATATTGTTCAGTTTCAGCTGGATCTGTG
ACTGATAGGCTCTCCTCAGCAGTGCCTGATGATGGGAGGA
ATTTCCCGCCTCTTTTTATTTGTTAGTCTGTTCTGTTTGT
TGTCGTTCTCTTTGTTTTTCGTTTGTCTGTTTTCAGAACA
AGCATGGCCAGGATGGGAGACTGCTCTGTAGTGCGTATCC
GTCTGCTGCAGGCTTTCCTGGCAACACTGTTTTGAAACGG
CAGACGTTTTTTTTTTGGGGTTTGTTTTGTTTTTATTTGT
TTTGAAACAATGTCCAACACATTTCCCCCCTCAGCAGCTG
TGAATACGAGCCACTTAGGGTCAACTCAGCCTATCAGTGT
TTTTAGCGGCGACGTGTTGTGCAGGTTGGTATTATTGTAC
AGCACAAAACGGACAAAGTTGGGACAAGCTCACACTTTGT
AATTTCCTTTAACACCAAACATCATCAAATCCTCTTGTTT
TAGTTTTTTTTTTTTTTCGGACGCATCAACGTAACATCTT
TTCTAATGGCTTTGTGAATCACTTTTTGTTATTTAAAACA
AACAAACAAACAAACAAAAAAAATCATCCATCAGAATTTC
GCACGC

ncoa1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA ncoa1-202 5926
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ncoa1-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000006175 (1),  Ensembl_Trans:ENSDART00000130513 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL923040 (1) 539 nt
GenBank:AL921547 (1) 535 nt
GenBank:DQ017644 (1) 531 nt
GenBank:AL918429 (1) 528 nt
GenBank:AL924908 (1) 356 nt
CITATIONS (2)