Transcript

wnt16-201

ID
ZDB-TSCRIPT-090929-6422
Name
wnt16-201
Previous Names
  • wnt16-002
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023277 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023277|OTTDARG00000019035|ZDB-GENE-040426-2330 wnt16|OTTDARP00000019377 wnt16-002 LG_ CT025718.7 Danio rerio protein_coding KNOWN, 2058 bp
GAGTTTGCGCTCATGGCGAAGGTGACTTGCTGGTGGTTGG
ACGTTACCTGCGTCTTGATGGATTCTTAAAACGGAGACTT
AAAAGCGTCGTTTGTGGATTACAGGTGCTACATATTAGAT
GCAGTGGACCGGCATGAATCGTCTTTGTCAAAACGTTCAG
TTCGGGACTTGTTAAATGAAGTGGACATGGATAATACCGG
TTGTGGGATACATGCAGTTCATCATTTATTCCTTATATGG
CTCTCCGTTTACCCTTTGTGCTCTCAGGGAAGTTGGATGC
CGACAGGAGAGGAGAACCGCTTCTGATCTTTGTGTCACAC
TGCTCCGCATCACAGGTGGTTGGGCATCACATCTGTAGGA
GTGCCCGAGAAGTTGGGTTGCGCGCATTTGCCCCTGTCGC
ACAAGCAGAAGGAGCTGTGCGCGCGCAAACCGCATCTTCT
ACCGAGCGTTAAAGAGGGCGCGCGCCTGGGCATCACCGAG
TGCCAAACTCAGTTCAGACACGAACGCTGGAACTGCTCGA
CCCGACGGGACCCGAACGTGTTCGGCTACGAGCTCACGAG
CGGGACTAAAGAGACAGCGTTCATCCATGCAGTAATGGCT
GCCGGCCTGGTTCATGCAGTCACCCGCTCTTGCAGTGCAG
GAAATATGACAGAGTGTTCATGTGACACAAGCCTGTTGGG
CAGCGGGTCGCCCACCGAGGGCTGGCATTGGGGCGGCTGC
TCTGATGACATCGCCTTCGGGACTTCATTCAGCCGCCGCT
TTATTGACAGTGCAGCGAAAAACACCTCGACCCGTGGTGA
GGAGGCCCTGCTCATTATGAAGCAGCATAACAGTGAGGCT
GGGAGACAGGCGGTGGCCAAAACAATGTTGACAGACTGCC
GCTGTCATGGCGTATCGGGTTCATGTGCGGTAAAGACGTG
TTGGCGCACAATGGCTGCATTTGAGCGTGTGGGCGCCTAC
CTGAAGGATCGCTATGAAACCAGCGTTCATGTTGTGGACC
GTTCCAAACGTAAGGTGCGACGCAAGGATAAAGAGCAACG
CCATGTGCCTATCACCAAAGATGAGTTAATCTTCTTCAAC
AAATCGCCCAATTATTGCTTGGAGGACCGGCGGCTGGGCG
TGACGGGGACCAGGGGCCGCAAGTGTAACAGAACTTCGGC
CGGGCCCGACGGCTGCAACCTGCTGTGCTGCGGACGGGGA
TACAACACACATGTGGTGCGACATGTAGAGCGCTGCGAGT
GTAAGTTCGTCTGGTGCTGTTATGTTCGCTGCAGACGCTG
CGAGACAATGAATGACATGCACACCTGCAAGTAAAGCAGC
GACTTCGGGCGAGGTTGAAGGATCTCGTGAGAGGAAATGG
ACCTTCTTTGTGCTGTCAGCCTATACAAACAAGCATGTTG
ACGAAATATCCAACCGGCAATACGTAGCTGAATCCATAAA
GAAATGGTATAATCCTTTTTTAAGTACACATGCATAACTC
TTCCCATGGGTTTCCATTGGGAGTCAAGCCATTTTGTATA
TAATGACTGTGGAATAAACTGGAGCATAAAGGGAATTCAA
ATACTGGGAATTGCAGAGGAAAAGTGTAAATACTTTAGAT
AACTCTGTTTGGATTTTTTACTGAAGGCATGTTCGGATAA
AGAGTTAGCTGACCTTAAAATGAAAAGTTTGTCAAAATTA
GTCTTTCCAACTCACCTCTTCACTTTTTCCCAACCCAAAT
CTTCATTAAAAAATTATTAAAAGTAGGATCACTCAAACAT
TTCGTAAATAAAAACTATTATTCAATTCAGTCATTATTCA
ATTAAAGTTCCGAGCAGTTCCTATTATTTAATTAAAGTTC
CAAGCAGCTTTACAAAAGGTGTTCATCATTAAATTACAGT
CAAAATCAGAAAATATAAACCGCTTAAAGGTGAGTGACAG
AATTTTCATTTGATGGCAAACTAACCCTACAACGATCAAT
TCTAGTGGGAATTGTGTTGATAATATGCCAAGATATTTTT
GATATAATGTTTTATAGGTTCCAAATAAGAAATCATTGAA
TAAATAATACCCAAAGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations