Community Action Needed: Please respond to the NIH RFI
Transcript

wnt16-202

ID
ZDB-TSCRIPT-090929-13238
Name
wnt16-202
Previous Names
  • wnt16-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000031352 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000031352|OTTDARG00000019035|ZDB-GENE-040426-2330 wnt16|OTTDARP00000025484 wnt16-001 LG_ CT025718.7 Danio rerio protein_coding KNOWN, 1183 bp
AGACTTAAAAGCGTCGTTTGTGGATTACAGGTGCTACATA
TTAGATGCAGTGGACCGGCATGAATCGTCTTTGTCAAAAC
GTTCAGTTCGGGACTTGTTAAATGAAGTGGACATGGATAA
TACCGGTTGTGGGATACATGCAGTTCATCATTTATTCCTT
ATATGGCTCTCCGTTTACCCTTTGTGCTCTCAGGGAAGTT
GGATGTGGTTGGGCATCACATCTGTAGGAGTGCCCGAGAA
GTTGGGTTGCGCGCATTTGCCCCTGTCGCACAAGCAGAAG
GAGCTGTGCGCGCGCAAACCGCATCTTCTACCGAGCGTTA
AAGAGGGCGCGCGCCTGGGCATCACCGAGTGCCAAACTCA
GTTCAGACACGAACGCTGGAACTGCTCGACCCGACGGGAC
CCGAACGTGTTCGGCTACGAGCTCACGAGCGGGACTAAAG
AGACAGCGTTCATCCATGCAGTAATGGCTGCCGGCCTGGT
TCATGCAGTCACCCGCTCTTGCAGTGCAGGAAATATGACA
GAGTGTTCATGTGACACAAGCCTGTTGGGCAGCGGGTCGC
CCACCGAGGGCTGGCATTGGGGCGGCTGCTCTGATGACAT
CGCCTTCGGGACTTCATTCAGCCGCCGCTTTATTGACAGT
GCAGCGAAAAACACCTCGACCCGTGGTGAGGAGGCCCTGC
TCATTATGAAGCAGCATAACAGTGAGGCTGGGAGACAGGC
GGTGGCCAAAACAATGTTGACAGACTGCCGCTGTCATGGC
GTATCGGGTTCATGTGCGGTAAAGACGTGTTGGCGCACAA
TGGCTGCATTTGAGCGTGTGGGCGCCTACCTGAAGGATCG
CTATGAAACCAGCGTTCATGTTGTGGACCGTTCCAAACGT
AAGGTGCGACGCAAGGATAAAGAGCAACGCCATGTGCCTA
TCACCAAAGATGAGTTAATCTTCTTCAACAAATCGCCCAA
TTATTGCTTGGAGGACCGGCGGCTGGGCGTGACGGGGACC
AGGGGCCGCAAGTGTAACAGAACTTCGGCCGGGCCCGACG
GCTGCAACCTGCTGTGCTGCGGACGGGGATACAACACACA
TGTGGTGCGACATGTAGAGCGCTGCGAGTGTAAGTTCGTC
TGGTGCTGTTATGTTCGCTGCAGACGCTGCGAGACAATGA
ATGACATGCACACCTGCAAGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations