Transcript

cfap73-202

ID
ZDB-TSCRIPT-090929-6385
Name
cfap73-202
Previous Names
  • cfap73-002
  • si:dkey-114c15.1-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023233 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023233|OTTDARG00000018998|ZDB-GENE-060526-194 cfap73|OTTDARP00000019348 DKEY-114C15.1-002 LG_ BX640539.14 Danio rerio protein_coding NOVEL, 903 bp
CACGCGCAGAAAGAAAGCTTGTTCACGCTACACTGAACTT
TTGAATGGCTGAAAAGATGAATTTGGAGGATTATTTTCGA
TTGGTTTTCGAAGAACGACTCTCATTAAATAAGGCCGAAC
ATGAAGGCTTCAAGGATATGAAAACAACTGCCATGCAACT
TCTGGAGGCGCGCGAGCAGAGCGCGTGCGTGAGCAGAGCA
CTGGAAGTCCAGAAAGAGGAGATGCAGATGAAACAGGAGA
GTTTAAAAGAGAGAGAAGAGAACATTAAAAAGGAAGAGGA
GAAACTAAAGAATTCCCTACTGCAATATAACAAGTTTTTG
CAAGAAAATGATGCCAGGCGGTTACGTGCCATAAAGAAAG
CAGAGGCAGAGAGAGCACAAACCAGACTGAAAGAACTGGA
GATTCAGAAGCTAAAGACGGAGAATGATGTCCTGCTGGCA
CGAAAAGAGCTGCTGGAAGAACGTGTCGGAAAAGCCAAAT
GCTACCAAGAGTTCCTTGAGAGAGCTGCAAAAATGTCCAG
AAAGTTTGAAAACCCTTGCCAAGTCATTGATCGTATTCAA
GCACTGCAGTCAATCAACAAGGAACTTCTAGAAAATCAGA
CAGTTTTGGAGAAGGAGAGAGAGAGAACAAAGCTGGAACT
GATGCAATACATAAATAAACAGCGAACAGCTCTTCTGCAC
TATAACAACCAACTGCACCAGCTACAGACACAGCTAGACA
ACATTCGCATAGAAGCATACAAATGGGAGATAAAACTGAA
GCACTTCCAAACCACAGCTGCAAAGGAGACACTAGAATTT
GCTCAGCTAAAGACCACAGTTCGTAACATTTATCAAATGA
TCATCACACATTACATCAGGAGGGTCTCTGAGCACACCGA
GGACACCTTTAAGCAGTTGGAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations