Transcript

cfap73-001

ID
ZDB-TSCRIPT-090929-6384
Name
cfap73-001
Previous Names
  • si:dkey-114c15.1-001
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023232 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023232|OTTDARG00000018998|ZDB-GENE-060526-194 cfap73|no_translation DKEY-114C15.1-001 LG_ BX640539.14 Danio rerio protein_coding NOVEL, 1070 bp
CGAACATGAAGGCTTCAAGGATATGAAAACAACTGCCATG
CAACTTCTGGAGGCGCGCGAGCAGAGCGCGTGCGTGAGCA
GAGCACTGGAAGTCCAGAAAGAGGAGATGCAGATGAAACA
GGAGAGTTTAAAAGAGAGAGAAGAGAACATTAAAAAGGAA
GAGGAGAAACTAAAGAATTCCCTACTGCAATATAACAAGT
TTTTGCAAGCAAGGCAACTTTCTGAAACAACTGCATCTAT
CAATGGATAATGTGTTTAGTGGCTTGGTGTTTGGTTCTAC
TTTAATGTCTTTCTCTCCATACAAGGAAAATGATGCCAGG
CGGTTACGTGCCATAAAGAAAGCAGAGGCAGAGAGAGCAC
AAACCAGACTGAAAGAACTGGAGATTCAGAAGCTAAAGAC
GGAGAATGATGTCCTGCTGGCACGAAAAGAGCTGCTGGAA
GAACGTGTCGGAAAAGCCAAATGCTACCAAGAGTTCCTTG
AGAGAGCTGCAAAAATGTCCAGAAAGTTTGAAAACCCTTG
CCAAGTCATTGATCGTATTCAAGCACTGCAGTCAATCAAC
AAGGAACTTCTAGAAAATCAGACAGTTTTGGAGAAGGAGA
GAGAGAGAACAAAGCTGGAACTGATGCAATACATAAATAA
ACAGCGAACAGCTCTTCTGCACTATAACAACCAACTGCAC
CAGCTACAGACACAGCTAGACAACATTCGCATAGAAGCAT
ACAAATGGGAGATAAAACTGAAGCACTTCCAAACCACAGC
TGCAAAGGAGACACTAGAATTTGCTCAGCTAAAGACCACA
GTTCGTAACATTTATCAAATGATCATCACACATTACATCA
GGAGGGTCTCTGAGCACACCGAGGACACCTTTAAGCAGTT
GGAAACGATTCAGAAATATTTTCAGCTTATGGAAGCAATA
GATGAGGATCTAAAATTCAACATTATGCCAAATCGAACTG
AAGAGAATGGCACTGGTGATTAATCTCCAAGCTTTGAAGA
TATATATATCCAGTGAAAATGGACGGATACGCGTAAGCTA
AATAAAAATAGTCACTGACCACATGTGTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations