header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6354
Transcript Name: lrsam1-201
Previous Names: lrsam1-001, si:ch211-208h16.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023180 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023180|OTTDARG00000018964|ZDB-GENE-060526-97 lrsam1|OTTDARP00000019297 CH211-208H16.3-001 LG_ CR925757.8 Danio rerio protein_coding NOVEL, 2166 bp
ATGTTTTTGTTCAAAAAGAAAAAACCCAGTGGCGATTCCA
GGAAACGTCTCGAGTACCAGCTGTGTTTGGCCAAAGAAGC
AGGTGCTGATGACATTCTGGACATTTCTGCCTGTGAGCTT
TCAGAGGTTCCCTCCTGTGCCTTCTCTATGTGTAAAGTGC
TTCAGAAGAAAGTGTTAATTCTTCATACAAATGACCTGAG
GTCACTCGTACCTAAAGGCTGCTGTCTTGGTGCCTTAGCA
ACATTAAAGGTCTTGGATCTACATGAAAATAAGCTCACAT
CACTTCCAGATGAGATCGGACAGCTTTCGTCCTTGCAGGT
GCTAAATGCAGAGAAAAACCAGATCAAACAGCTGCCAGAC
ACTATAGGAGGTCTTCTGCATCTACAGACACTTAATGTAA
AAGGGAACTGCCTTACTGTGTTGCCTGTGTCTGTGGGTCG
CATGAGCAGCCTGCGGACACTCGACATAAGTGAGAACAGC
ATCAGAGAATTACCCAAAGAACTGGCCAGTGTTCGCACTC
TGGAAAGCCTGATCCTGGACGCACAGGTTATGAGCTTTCC
ACCTGCGTCAGTGTGTACAGGCGGCACAGAGGAAGTGCAG
CGCTACCTCTGCTCAGATATGGGTCTGGAGTATTGTCCTC
CATCTCAGTATCTCCTGCCTGTGCTGGAGCATGATGGAGG
GAAGCAGGAGATGGACTGTGTTGATGGTGAGGAGATAGTC
TGGCAGAACAAATTTATGGACTATGAGAAAAGAAAGGAGC
AGAAACAATTGGAAAAGCTGATCTTTGAGAAAGATCTTGA
AGAGAAACAGAGAGAGCATGCTAAACTCCTAGTCCTCAAC
AGCTCTCTTAAAGAGGACGTCCTGCTGTCTGTCAAACTGG
AGCAGGAGCGGTTAGAGTTAGGTGTATCTCAGCAGCAAAA
GGCCCAGGAAGCAGAGAGGCTGAAAGTGCTGGATAAAGTC
CGCCAGGCAGAGAGCGCTGTCATGAGTCGCATCTCTGATC
TTCTGCTTGATAACAAACGCCAGGAAAAAAGCGCTGCATT
TTTGCAAGCCCTGGAGAAGGACCGCATACGAATGGAACAC
CTTACTACCATCACACAGGAAGAAGCCAACTCTCTTAGGA
AAAAGGAAGTGGCAGATGCCATGCAGAGGATGTTGTCCGA
GAGCTGCTCTGTACGGTTACTGCAGGAGGCCAGAGAAGCC
AAGACAAAGTTTCTAGTGTCCGAAACCTGCAAGAGTTTGG
ACAATATGGATAAGAAGTTTGACCAAGTGTTGTCTCTTCA
GCAGCTAGACAAAAGCAAAGCCATTAGTCAGATCCTTCAA
GAGGAGGAAATGCAGAAGGCCGCCTTTGAAGCCCTTCAGC
TCCAGAAAGACAGCGTGCACGCTTATATCCGTAATCAGAT
TAAACTCATAGAGGCAGAGTTAATGCAGCTCACAAAGCTG
GAGGTTAAGAGGAGGAATTTGGACACTGAGAACCTGCAGG
AGGAGCTGTCTGACCAGAGGACGGCTCTGACTGACCTGCT
GCAGCAGTTACTCAAACAGAAGGATCAGAGGGAGGAGGAG
CTCAGACTGGTCTTGATGGAGATTGAGAAGAAGAGTGAAT
CCAACCAGCAGAACTACTGGATGATCCAGTATCAGAGGCT
TCTGGATGCCAAACCACTGTCTCTGCGCATGCAGGAAGCA
GCGGTAGACAGAGATCTAGGGAATCTACTGTGCAAACTCT
CAGCTCAGCACTACCTGCCAATCATAGCTCACCACCGCAT
CACTGCTGAGGCCTTAAGAAGAATGACTGCCAAAGACCTC
AGGAAGTTGGGGATCAACGAGGTTGGCGTGCAGAAAGCTC
TTCTCCACTGGGCCAGAGATCGAACTCTGTCTGATCCTTT
GCCGAAAACACTGAAAGAGATGGAGGAAGCTGGTCCATTC
GCTCAGAGTGTTCCACTTCCACATCAGCTCACTCCTCCAC
TGACCCCCAGTGCACCTCTAACCCCCACGACCCCAAATCC
TGACCGCTTCAACTCTGAGTGTGTTGTCTGCATGGAGCTT
GAGTCTCAGGTGATCTTCCTGCCGTGTGGCCATGTATGCT
GTTGTCAGACCTGTAGTGATGCCCTGCAGTCGTGCCCTCT
GTGCCGTGGCTCTATATCTCAGCGTGTCCGTATTTACCAT
GGCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
lrsam1-201 Contained in:
OTHER lrsam1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023180 (1)
  • Ensembl_Trans:ENSDART00000085769 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CR926617 (1) 529bp
    CITATIONS (2)