ZFIN ID: ZDB-TSCRIPT-090929-6341
Transcript Name: alpk2-001
Previous Name: si:ch211-233a1.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023149 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023149|OTTDARG00000018940|ZDB-GENE-030131-1868 alpk2|OTTDARP00000019269 CH211-233A1.1-001 LG_none BX248399.5,CR925730.6 Danio rerio protein_coding NOVEL, 5234 bp
TGCTAGCACTGGTTCTAAGCTCGGTATGGCAATCCAGGAC
AACATTTTGGAGCAAAGGACAAGTTCCGATAATGCAAACA
ACGATGAACAGACATGCCTGTCCCTGAACCTTATGCAACC
AGATGAACCAGGTCAAGCCTTGGAAAGAGGACTAGTCAAG
TCAGATAACACTAATGGAACTGTTTTTAAACAAGGAGATA
AAGAGAGACTTGCTTCTTGTTTAGACATGGACAAAGATAC
CACAACAATGGAGAGCCAAATGAGTTTGTTGGAGACGTCG
ACTCCCGAATCCCATAAAGCAGATAATAATGCAGTGATGG
AAACTTTTAATGCATCTTTGACTCATGAGTTCAATGCCAA
ACTACACGGAAGTCTGGATATCTCTGGAAAGCTTTTGAGT
GCAAAGCGGGAGGGAAATGTGCTGGTGGAAGTTACTGGAG
GCAAAGTTTCCCAACTCGGGTTGGTCTTCGAGGAGGAACG
TCAAAGCATTTTTACTTCCCCGAGTAGCTCAGCTTACACC
AGAGACAAGAATTTAACTGGCTGTGTGAGCAACGAAGAAA
GGTGTCACAGCTCTGATGTGCATCTCTGCATATGTCCCTC
TCAATCGGACAGTCACGTGTCTTCTAAGGCGGGACATGCT
GAAGGAAATGGATCATTTCTACATTCTAACATTGGAAACT
GTACAGTAAAGCCATATGTGGAAGAAAATATTCCACAGTT
TATAATGCCGTTTGCTCCAATTTGTACTGGAAATACTTTC
CTGCATCGTAGTTTTCTGAAAGAGGACAGATCACAGGCTG
ATCTAGATCTTCCTGATAAAAAGATTATTAACAAGATAAA
CCTTAAGAGTAATAAAAAATCAAGCAGCAGTGACGATTCT
TCTGAAGATAATTTTCATACATGTCCTGACCAGTCTTTAT
CTTCATCCTCTGGAGATTCGGATGATCCTTCCATCACAGA
TTCTGGTAGGAAACCAGCGTACAGTGATACATGTGACATC
GGCAAAGAACTTTCTAAGTTACTTTTACTCACTGGAGAGC
ATTTTATGGTGTCTGAGGACAAACGCATTGCATATGTGAC
TCTAGACTTGGACGAATCCCAACATTTTGGACGTTTTTCC
TTGCCAAACTGTGAAAAACAATCTAAACCAGACAATATGC
CCCATAAGACCTCTAAGACTTCCTCAGATGGTAAAATGCG
CTCTAAACATAAGGAGAAACCAGATGACAAGCAGCAACAT
GGGATTCAAGCATCAAAAAAGCAAGATCCGCAGCCTCAAT
CTCAGGTGAAAAATGAAGGAGCAGGTTGTGAAGATTGCCC
AGTTGCTGTTATTGAAACTATCGTCATCACAGAGAAGATC
ATTCCTAAAACTCAAGGGAAGAAGAAAAAGAAGCATGTGC
AACATGGGACACCAAAACCCGAGAATGATGCACCGACTGA
TGTAAGGAGTGAAAGCAGACAGAAGAACGTAAATGGCAAG
GCTGAGAACCTTGAACTAAAAGTGGCATCAAACAGTCTGA
ATAAACCAGTGGCCCAGCCTTCAGGCAAAACGGACATTAC
TAAAAAAGACAGCGCTCAGAAAGTCATGTCAGTGAGACCC
AAAGTAGAACCCAGCATGGCCAAGATGGATCCAGCCGGTG
TAAATGCCACTCAGAAATCCAGCCCTATTAAACTCAAAGC
AGACACCTTTAACACAGCCAAGATGGAAAATAAGACGTGC
ACCACAGATTCTTTGAGCACATGTTTACCCAGCATGCTGA
ATGATGACATTAAACGGAGGCGAATCGCAGACGACCTGTC
TAGAGCAGTTCCGATAAGGACAAGGCCACAGCTGCCTGCC
ATTTTCCGCCAAGCAAGGAAAGATGGGGAAGATGTGACCC
GGAGAGCTTATAGTGAGGTTGTCAAGCAGAAGAATTCAAC
TCCCAAAGAAGTTGTGGTTCCACGTGTAGTCTCCGAGATC
CAGGCTGATCCAGTTCCTGCTGACCCCCAAAACATCTCGC
TTTGGTGCCAGTTCAGCCCCATTCCACCTGAAGCCACCAT
TAAGTGGACTAAAGAGGCAGCAGTTCTGTCAGAGATAAAC
AAAGTAGAAAAGGAAGATGGGCGCTTCACACTGACCATTA
TAAAAGCTTGCAGTAAAGATCTAGGCTTTTACAAATGCAG
TCTGATCGTTGCCAATATTTCTGTTTCGACCTCTGAGTAC
CATCTCACATCTGAGGTTCTGATGGAACTAGTCATTCCAA
GTCACGATCAACCAGCTGAGCCCAGAGTTATGGAGGGGGA
TGAAGAGAACATCCAGTGCAGTCCGTTGCTCTTTAAGGAG
GATTTTTTGTCAGATCAGTATTTTGGAAAGAATCAGCCTG
CGAGCATCCTGACAGAAAAGGTCCACTTTGGTGAAGGCAT
GCACAGAAAGGCTTTCAGGACCACTCTTACAGAAGGCAAC
CTGCCACGATTCAGACCCGGCCACCCATGTGTCCTGAAAG
TCCACAACTCCATCAGCTACGGGACCAAAAATAACGAGGA
GCTTGTTCAAAAGAACTATAGTCTGGCTGTGGAGGAATGT
CATGTGCAGAATACGGCCAGGGAATATATTAAAGCGTACA
ATAGTGTGGCCAAATCTGCAGAATCGTTTGGAGACCTGCC
AGAGATCATCCCTATTTACCTGGTTCACCGGCCATCGAAC
GACATCCCTTACGCCACGCTGGAGGAGGAGCTGCTGGGAG
ATTTTGTGAAGTACTCAGTGAAGGACGGGAAGGAGATCAA
CCTGATGCGTAGAGACTCAGAGGCCGGGCAGAAATGCTGT
GCCTTTCAGCACTGGGTTTATACACAGACTGAGGGCAACC
TGCTGGTCACAGACATGCAGGGTGTGGGCATGAAACTGAC
AGATGTTGGAATTGCTACCTGTAAGAAAGGCTATAAAGGA
TTCAGAGGAAACTGTGCGACATCCTTCATCGATCAGTTTA
AAGCTCTTCACCAATGTAACAGGTACTGTGAGTTACTAGG
CCTTGTGTCCCTCCAGCCCAAACCCAAGCGGACCGTCGCC
CCGCCAAAGCCAAAAACACAACCTGTGCCAAAGAAGAAAA
CCTTTGGGCCCGTTCTGAATGCCAAATCCTGATCGCACAG
AAACCCTGAACATTTTCTTGTAAGCTTAATAGGTGTTTGA
AGACCGTAATAATGACGTCTTGCTCAGGGACAAACATGTT
TCTGAGCTGTTTCTTAAAATGTAAGATGACATTCATCTGT
AAGGACAGTAGGGAGTTTACTTCTTTCTTGAGAGTTTTTT
TTTTTGTGCTATTTTAAAAGAGCGTATTTGTTTTTTTTAA
TGTTTTTTAAGAGTAGATGCTCACAGAATTTATATTAAAT
GTTAATGACTATCTTTTGTTTTGTTGGTTGTTCAAATTGA
GAGAATAATGGAGGGTAAAAGTCAGTGTTTTTTCTGGTTT
GTTTGAAAAGTTCTGAATTTTGCCAGTGTTGCTGCCATCT
GCTTCTTTATTATTAGCCCACAGGCATTTTTGTTTTATAG
ACAAGCCAAAGCAACAACAACAACAAAAAAGGTTGGAAAT
GTTTCATGTTTTTTCTTGCGCTACATTGGTGAAAATAAGT
ATTGAACACGTCACCAGTTTTCTCAGAAAACATATTTCTA
AAGGTGCTGGTGACTTGCCCAGATGTTGGTAACAACCGAA
GAAATCCATATATGCAAAGAAATCAAAATGAATTAGTTTA
CAAATTAAGCTATGCATAATAAAATGAAATGCAAAGGAAA
AAGTATTGAACACATGAAGAAAGGAAGGTGTAGAAAGACA
GTGAAAGCCTAGACAGCAGCTGAAATCTCTCAGTAGTTCT
TCAGCAACCCTCTGCCCTTTCTCATTCCTCATTAAATTAA
TATTAGCTGCTTCAGTCCAACATCTACAGTACATTAGCAG
AAGGATGAAGATGAAACCATGGTGAACATTTTAGCAAGAC
AATAACCCAAAACACAGCCAAGAAAACTTTTCAGAGAAAG
AAAATCAAGCTGTAGAATGGCCCAGCCAATCACCTGATCT
GAATCCAATAGAAAATACAAATTAAAGATCAGACTTGATC
GACGAGACCCACAAAACCATCAAGATATGTACACTGTTGA
AGTCTGTGAAAAACACACCTGAGCGCTTAATGTGACTTTA
TTCTTCATATGAGATGCATCTTTAACCTTCCATCACCAGA
AAAGTCTTTTATAGACAGCATTAAATACGTTTAGGTAGTT
CAGCATTTTCTCCTTGTGTTATAACATTGTTATTAAACAT
AACTCATTGTTCAGATTTGTTTTGTTGTTTTGTTTAATTT
ATGTTTGTATTGTTTGGATTTTTACCAAAATCTGGTTCAA
TTTCATGTCAACAGCTCCTTTAGAAATATTATTTCCAGGA
AATAAAACATGACGAGTTCAATACTTATTCCCCCTGCTGT
GTATGTTCGCATTTCTACAATACTTAAAATAACCACTACA
GCTTAAATAGATATTTACTTGATGAGTGGTATTAAAGTAA
AACATTATTGTAAATGTAAAAATGTATTGTTAGCAGCTGC
TAAAATTTACATGCAGAGCCAAATCTTTATTATCATTATT
TTTTTAGACAAATGTATTTAGAGATTCATAATTATTATTA
TTTTTTTCTTTTCATTGTTTATCTGTTAATCTTTGGAAAG
GGTGAACTGGAAAAAAACTATTTAAATGGGCTGAATGTAA
ACAAACAAATTAAATTTAGTAGTTCATCTTAATTTGTTTG
GTTGGAAAATTTATTTGGGCTGGATTTAAATATTTACCTT
AAAAATGTAGTAAATTCAATGAATCTTTTATTTCAGTGTA
TGATAAGGTAGTAAATATGATCCAATGGAAAATTTTGTAC
ACTTGCCCTAGTAAACAGCTGTTTATTTGCCTCAGTAAGA
ATGACAAACCTTCCACCTTCACGTTTCCAGCATCCTTTCA
AAGATCAAATGACTTACTGCCTCATTGCTATATATAAACC
CACACGTTTAAAGCGATGTATTTGTCCTGTTGATACTAAT
GAACCGCACAAATAAACTGTGATGTTAGCCACTTTTTGCT
TATCTAGATAGTCTTATCTTTAAGTATTTGTAGTCTTAGT
TGTTTGGATTGAAGATTCAAGTTTTTAGATTCTTGGCTTT
ACTGAACCACAATCCACTTTGAATGAGCTTGTCTGAATGG
TATATTGTATAATAATAAATATTGTTTTTCATTA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
alpk2-001 Contained in:
OTHER alpk2-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023149 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN317343 (1) 911bp
    GenBank:CA469785 (1) 898bp
    GenBank:AL912785 (1) 537bp
    GenBank:AL912786 (1) 518bp
    GenBank:AI584765 (1) 485bp
    GenBank:AI584257 (1) 452bp
    CITATIONS (1)