header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-6338
Transcript Name: nedd4l-202
Previous Name: nedd4l-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023146 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023146|OTTDARG00000018937|ZDB-GENE-051118-2 nedd4l|OTTDARP00000019267 DKEY-277M11.1-001 LG_none CR925730.6,CR318662.11 Danio rerio protein_coding NOVEL, 4936 bp
GATTCGCGTTTGCACTTGACGAGGGGAAATCATATTGTTG
GGGGAAATTAAGCGTGTATCCACCTAAATTCCGCCGTTAA
ATGAGATTAAACTGGCGGACGTACATCTTTAGGCACGATA
TGGTTTAAAAGGATAACCGTTTTTGGAGTCAGACTTCGTT
GCTTTGGATTAACTTGGAGGTGGAGGAGGACACACTTTGC
TATTGTTCCAGCTTTCACACTAGTGTGTGTGTGTTTTTGT
GTATGTGTGTGTTAAATTGCCTTTTGGCTTTATGGCTACG
AATTTTGAACCCATTTATGGACTTTCAGAGGATGAAAACG
AATCTCGTATTCTTCGCGTCAAGGTCATTGCTGGCATTGA
TCTTGCGAAGAAGGACATCATTGGTGCCAGTGATCCATAC
GTCAAACTCTCCCTGTATGTCGCTGATGAAAACCGCGAGC
TTGCCTTAGTACAAACGAAAACCATCAAAAAGACTCTTAA
TCCCAAATGGAACGAGGAATTCTATTTCAGAGTCTGCCCA
CAAAACCACAGGCTTCTTTTCGAGGTGTTTGACGAAAACC
GCTTGACCAGAGATGACTTCCTGGGGCAGGTGGACGTGCC
TCTTACACACTTACCGACTGAAGACCCTGCCATGGAGCGT
CCATACACGTTTAAAGACTTTCTCCTGCGTCCAAGAAGTC
ATAAATCTCGGGTGAAAGGTTACCTGAGGCTCAAGATGGC
CTACCTGCCAAAGAATGGAGGACATGAGGAGGAAAGCGGT
GAAATGAGAGAGGAGGCTGAGGGTTGGGAAGTGACAGACT
CCACAGATCCAGGATCTCAGAGACCTCAGCAGCTCCTGCC
TCCTCTTCCTCCGGGCTGGGAAGAGAAAGTGGATAACCTG
GGACGGACGTACTATGTGAACCACAACAACCGCACCACAC
AGTGGAAGAGGCCCAGCAAAACGGAAAATGATAATCAATT
GCGGCAGATTAACCAGGAAGCCCACAGAGTTTTCCGCTCT
CGACGGCACATTAGCGAAGACCTGGAAAATGAGCAGCTGG
ACATCAGGGACATAGACGACTCATGGGAGCCCATATCAGA
GGAAGATCCGACTTTATTAACAGATGGTCTGAACCATTCT
CTGTCGGGACCCTCCTCTCTGGCAATGCCCCTCTCCAGCA
CTCCAGACTTCTCAGATGAGATCAGCCTTAGATTGTCTCT
CGCTCCAGACACCAACGGAGAAATCCCGGGACCCAGCTCT
GCTGTGCAGAGTCATCTTTCCTCTCGGCTACGCTCCTCTA
GTATGACTGATGGAGTCAGTGATCAAGCTCAACCTCCCAC
ACCAACGAGCTCCCAGACCCGACGAACAAGAGCACAAACC
GTCACAGGCGTTGAGGACACCATGTCTCCTTCGGCCTCTT
ACGCCTTGACCACGCCAGGCCTTCCACCAGGCTGGGAGGA
ACGCAAAGACCCCAAGGGACGAACGTACTACGTTAATCAT
AACAACCGTAGCACCACATGGACAAGGCCCATTCTGCAGC
ACACTGAGGATGGAGCCAGCACCTCGGTTGCAGCAGTAGG
GGGCGCTACAGCAGCTACACCCCCTGCTTCAACCCCTTCC
ACCTCCAGCGGCCATCTAAGCGAACCACAAGTGCGCAGAC
CCCGTAGCCTCAGTTCCCCTACCGTCACTCTCTCTTCCCC
ACTAGAGGGAGCCAATAACGTCCCTATACGGCGAGCCGTA
AAGGACACATTCTCCAACCCTCAGTCTCCACAGCCTTCGC
CCTACAGCTCACCTAAAACCCAGCATAAAGCCAACCAGAG
CTTCCTGCCACCGGGATGGGAAATGAGGATCGCACCCAAC
GGACGGCCGTTCTTCATCGACCACAACAGCAGAACCACCA
CATGGGAGGATCCCCGCTTGAAGTATCCCGTTCACATGAG
GACAAAAGCGTCTCTAGACCCGGGCGACCTCGGCCCACTT
CCTCCTGGGTGGGAGGAACGAGTGCATGCTGATGGAAGAA
CCTTTTACATCGATCACAACAACAAAAAAACACAGTGGGA
AGACCCTCGTCTCCAGAGTCCTGCCATAACTGGACCCGCG
GTGCCGTATTCAAGAGAATTCAAGCAGAAATACGACTACT
TCAGGAAGAAGTTAAAGAAACCGGCAGATATCCCCAACCG
CTTTGAGATGAAGCTGCACAGGAATAACATCTTTGAGGAG
TCCTACAGACGAATCATGTCCCTCAAGAGACCTGACAGCC
TGAAGGCCCGTCTGTGGATTGAGTTTGAGTCAGAGAAGGG
TCTGGATTATGGCGGTGTGGCCCGAGAATGGTTCTTCCTG
CTCTCTAAGGAGATGTTCAACCCTTATTATGGGCTGTTCG
AGTACTCGGCCACAGATAACTACACCCTTCAGATCAATCC
CAACTCTGGCCTGTGTAATGAGGATCACCTCTCATACTTC
AAGTTCATTGGTCGAGTGGCCGGCATGGCTGTTTATCATG
GCAAACTCTTGGACGGTTTCTTCATTCGACCGTTTTATAA
GATGATGCTGGGCAAACAGATCACACTGAATGACATGGAG
TCAGTGGACAGCGAATACTACAACTCCCTGAAGTGGATTC
TGGAAAACGATCCCACAGAATTAGACTTACGGTTTTGTAT
TGATGAGGACAACTTTGGACAGACATATCAGGTAGATTTG
AAGCCAAGCGGATCAGACATGGTTGTAACCAACGACAACA
AGAAGGAATACATCGATCTGGTGATTCAGTGGAGGTTTGT
GAACAGGGTCCAGAAACAGATGAACGCCTTTTTGGAAGGC
TTCACTGAACTCATTCCCATCGACTTAATAAAGATTTTTG
ATGAAAACGAACTGGAGCTGTTGATGTGTGGTCTGGGAGA
TGTGGATGTCAATGACTGGAGGCAACACACTGTCTATAAG
AACGGCTACTGTCCAAATCACCCCGTCATCCAGTGGTTCT
GGAAGGCAATGTTGTTAATGGATGCAGAAAAGCGCATCAG
GCTTCTACAGTTTGTCACTGGAACATCCAGAGTGCCAATG
AACGGCTTTGCTGAACTCTACGGTTCCAATGGGCCGCAGT
TGTTTACTATTGAGCAGTGGGGAACTCCTGACAAACTCCC
TCGGGCTCACACCTGCTTTAATCGCTTGGACCTCCCAATG
TATGAAACGTTTGAAGACCTGCGAGAGAAGCTTCTGATGG
CGGTGGAAAACGCTCAAGGCTTTGAGGGCGTCGACTAAAG
AACCCCCCTCCCCTGTTTTATACACCTGATCTCCTAATGC
AACCGACGAGCAAAGACATGTACAACACACACATATCTAA
ACTCACATACACACTCTCTCTTTCTCGAGTTGCCATTGTA
CAGCCAGATTGCAGCAGCCGCAGGTGTGTGTGATGTCAGC
AGTATATGCATGTATCTGTCTAGCTGGAACGGCATTAGCT
GTCAACCCTGTCAAACAAACAGTCCTGCAGTACGTCAAGA
TCTTTCCTGACAAAATCACAATCTTTCCTGACATGTTTTA
TTTTTAAATTCAGCTATGGATTCTAAACTCCAGTATTTGA
AGCCCCCAGTGGGTGTGGCCTCAGAATGGGTGTGGCCTTG
ATCCAGCATTAAAAACCACCCTTTTTTGCATTACGTTCAG
CAAAGTGGCAACAACGAACTCTTTTATCAGGTTTAACTAA
CACCAGATTACCTTAGGAATGACAGCCAGGATGAAGGTCC
CAATCCTCATCCTCCCTTATCCCACAAAATACGCCAAGTT
TCCTTCCTTCCTTGGTCGAGGATTATTTTTTTATCGTCTT
TCGCAATGCCAAGAAGCAAGCAGTTGTTTTTAATAGTTTA
TTATTCTCGCTGTTATTATAATTATCTTACAGAGTAAACG
GATATTTGTACCAACAATGTGGTTTACTATTTTAAACGAC
AACATTATCAGAAATGCATCAGTGGCCTGGCTATATTCAA
AATTCATATCATCGTGGGTAAAAAAACAAAAAAGACAAAA
AAAAAAAAAACATGATCGACATGATTATTGTATTGCTATG
AAAACTGGCATGCACATGTATCTTGTGTTTCAATATGATT
GCGTAGTAATTCTAAAGCTATTCTTCTCAGTTCAGAGCAA
AGATCGGCAAAGTGGTTTTGACGGAGAGGGTTTTCTTCAA
TTGTAAAAGTATTGTTCTTATCTTTATTATGATTATACCT
GTTCATAATGCTGTAAATGAGTTTTGTTTCTGGGAAAGAA
GCGGTTGGACTCTTTTACTGTACGTGTTTGAAGTATTAAA
GAACGACACAGAGTGAAGCTATCTTAAAAAAAGCGCTGTG
ATTCAACACTGCAAGTCTTGTAGACTTTCAGGTCGTAAAC
TTTCCTTCTTTCTGTCTTTCTTTCTTTCTTTGTTTCTTTT
AACACCACTGTACCTAAAAGGGCACTTTATTGATCACACA
CTAGGGTCATAACACGTCTATTTGTGAACTTGAATGTGAT
TATCTTTTTTTTTTTCTTTTATAAGCACTCATTCACCTGG
TGCAATATCTATTGTTTATAATCGGCCTGCTGCTAACATA
TCAGATTACAGCTCGTCCCTACAGCAAATCTGGAGTCACT
CTGCTTCAGTATGAACCTGAAGTCATTTTGGTTCTTCAGT
GTGAATTTGCAGTCACAATGAATCTAGAATCACTTATTGT
TCATCAATGTGAAACTGGAGTCTCTCTGGTTCTTTAGTGT
GAATCTAGAATCACTTTTTGTTCATCATTGTGAATCTAGA
GCCTCTCTGGTTCTGCAGTGTACATCTCCAGTGACTTTAG
TTCATCAGTGTGAATCTGGAGTCTCTTTGAGTCTTCAGTG
TGAATCAATCTAGAATCACTTTGGTTCATCAATGTGAATC
TGGAGTCTCTCTGGTTCTTTAACCAGGATCTAGAATCACT
TTGTTTCATCAACTCA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nedd4l-202 Contained in:

OTHER nedd4l-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000023146 (1)
  • Ensembl_Trans:ENSDART00000146576 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK019293 (1) 877 bp
    GenBank:CK142344 (1) 802 bp
    GenBank:DT056871 (1) 778 bp
    GenBank:DT072717 (1) 769 bp
    GenBank:CO815721 (1) 756 bp
    GenBank:CO799861 (1) 752 bp
    GenBank:CF999445 (1) 751 bp
    GenBank:EB891050 (1) 727 bp
    GenBank:DN898271 (1) 708 bp
    GenBank:EB934335 (1) 587 bp
    GenBank:EB892097 (1) 499 bp
    GenBank:EB842982 (1) 391 bp
    GenBank:EB780550 (1) 368 bp
    GenBank:CO356692 (1) 340 bp
    CITATIONS (2)