ZFIN ID: ZDB-TSCRIPT-090929-6326
Transcript Name: osmr-201
Previous Name: osmr-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023118 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023118|OTTDARG00000018917|ZDB-GENE-060526-48 osmr|OTTDARP00000019247 CH211-14B14.2-001 LG_ CR318610.8 Danio rerio protein_coding NOVEL, 2346 bp
GTGAATGTTAGCAGAGGATTACACGCAGTGATCTGGAGCT
CTCAGCTGCCTCTGAACTGTGTAAATCACGCTGTCAGAAT
AAGACTCATCACTGCAGCTTCAACATTCAGCTCCTGGAGT
CCATGGAAAACCAACTACGGCGAGGTGAGCTCGGATGAAA
TCCTGCTGTTTCCAGATGACCAGGTGTTACGTGAAGGCTC
AACGGTGATGTTCTGCTGTGTTTATCCCAGAGACACTTCA
CACATCAGCTCAATGTTCTTGGGCAACACTGCCTACAAAG
TCATCAACATCAGCCCCCGAGTCAAAGCCATTCGAGTGGA
CAACCTCAAAGCCACCAATACATACGGCGTCAACTTCTAC
TGCGATTTGACCAGTGATGTAGCTTATAACTTTGTCACTT
TTCCTCCTGAGAAACCTCAGCACTTCAGATGCGAGACTGC
AGACATGCATAACATCCACTGCTCATGGGAAATACTCAGA
GCTCCAAACCTAAACGGCAGTTATAGAAGGACGTACACAC
TACTAATCAGTGACTCCAGAACTGTAAGCTGTAATTTCAA
TCCTCCATCCTGCAGTTTTAAAGTTGTGCCACATCAGATC
ACCTACAACGTCACCTTACTTGTGAGAAACAGTTTGGGAC
GAGAGAGCGAATCTGACATATTCAATATCACAGACAGAGT
TTTTCCGATGCCTCAGCGTCTTGAAGCGACTGCAGGTGTG
TTTGATTCACTGGTGATCTTACATCTGAACGGCAGTTTCA
GCGGACTTCAACTAATTTGCCAGATTGAACTTGAGCCAGG
AGGAACCGTACAGGAGTCCGTTCAGGATGGATCAGACTCA
GTGCAGCTGTATTTGTTCAGACTGCAAAACCTCAAGCCAA
GCACACAGTACGCCAGCAGAGGGCGCTGCGCAGTACAGGG
CAAACACTGGAGCCATTGGACAGCACAGCAGCTCTTCATC
ACAGAGCCTCTAGTGACTGTAGAACTGTGGAGACAAATCA
AGAAACATCCCAATCGCAACATCACACTTCTGTGGAAACC
TGTCAGCAGTGACCCGCAGCTGTACATTGAAGTGTATGAG
GTGTGTGTGAGCAGCATTAGTCCACAGAGGAGTGTGTGTA
TGAACGTCACACAGACGCAGGTGGAGTTAAACGCAGATCT
CCACATGTATGATGTCACCGTGCAGGCTGTCATTCGCACT
GGTCTATCTGTACCGTCACACATCACCATTCCTTCAGCAT
ATACAGAGGAAAAGGCTATTTTTGCTTCACATTCAGTCGT
AAAGAGGATTATGGGTAATGATGAGGGATTCCAGCTCACC
TGGACGAGAGACTCTGGTGCTACCTGTGATTATGTCGTAG
AGTGGTGCATACTGGGTATTGAGCCTCCCTGCAATTTACA
GTGGAGGAAGGTTCCAACCAATCAGACATATTTACAGCTG
AACGCAGGAGATTTTACAGCAGGAGTTCAGTACATGTTTA
AAATCTATGGCTGTGGCGCTGATGGACCCAGACTTCACGA
GAAACAGACTGGATACCTCAAAGAACTGAGGCCAAAGCAG
TACCCAACACTGCTCTCTCATCCAGACATCACCTGCTCAT
CTGTAAACCTGACATGGAGATTTAATGAGCAGGATCCCAA
ACACCCTGGATTCATTACAGGATATGTGATCAGAGTCCGT
TCAGAAAGCGGTTCTGAACTCCTTTCCTTCAGTGAGTCGG
TGAATGACCCTCACAGCAAGTCTCTGACTGTCAGCGGACT
CCAGGAGAACCAGCCGTACACATTTCACCTGGCTGCCTGT
ACTTCTGCAGGCTGTGGACCAGAAAGCAGAGCCACCTTCA
GAACCAGACAGAACTATGAACTGTGCTTGTATTACACCTG
TAGTGTGCTGATGATGATGATGATGATGCTGTATATCTCA
ACCGCGTTCAGAATAAAAGGATTTCTAGAAGAATCCTTCA
GCTTTCTACACATTAAAGCACCAGACCTGGATGAAGATCT
GTATGAGGCGAGTGAGAAGATCCGCAGACTGCAGATCGAG
GACTGCAAATGGTGTGACGTGGAGATTTTAGACATTCGCC
ACACAGCGTTAGAGAAAACATATCTGTCGGACGCAGAGGA
CCAGAACTGTGCTCTCATCAGCCCTGAAATCACTCTCTCC
TCCTTAATAAAAACATCCCATCACCTTAACACGGACATCT
GGACAAACACAGGCCTCACAAACTTCACCTACTTGTCTTC
TGCGCAACCAAACAGCCTGGAGAGCAAACAGCTAACAGAG
ATCTCCAGCGACTATGTCACTTCTGTGGCCACATATGCGA
AACACGGTGAAGCGAACCAGAGCTGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
osmr-201 Contained in:
[BAC] CH211-14B14 (1)

Genome Resources: Vega_Trans:OTTDART00000023118 (1),  Ensembl_Trans:ENSDART00000171701 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)