Transcript

srek1-201

ID
ZDB-TSCRIPT-090929-6269
Name
srek1-201
Previous Names
  • srek1-001
  • zgc:100974-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023049 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023049|OTTDARG00000018877|ZDB-GENE-040801-132 srek1|OTTDARP00000019205 CH211-10H13.1-001 LG_ BX950207.16 Danio rerio protein_coding KNOWN, 1879 bp
ATTCCATGCTGTTTGCAGCTCTCCTTGCTATCGAGTATTT
TCTGCAGGTCAGTGCCGAATGTTGGCCATTTGATGCATTA
TTGCATTTTACAGTATTGAACCTCAGTTTAGTGTGAAATG
AGCGGTATGCCCGGAACCAACGTGATCCAAATAACTAATT
TGTCGGCGGCGGTAAGCAGCGATCAGATGAGAACTCTATT
CGGCTTCCTTGGGGACATCGATGAGCTGCGACTCTACCCG
CCTGACAATGCACCCCTTTCCTTCTCATCAAAAGTTTGTT
ACATAAAGTATCGGGAGCCTTCGAGTGTTGGTGTGGCACA
ACATTTAACCAACACTGTTTTTATTGACAGAGCTTTGATT
GTTGTGCCCTGCGCTGAAGGAAAAATCCCAGAAGAGGCAA
AGGCACTCTCGCTTTTGGCTCCTGCAACACCTGTGGCCAG
CCTGATGAGTGGAGGAGGACTTCTGCCAATTCCTAGCCCT
TCTACACTACAGAATCGGAGCCTCCCTTTAGCTAACCTGG
GGGTCCTGAAGTCTAGTTTGGACACTTCTGTGGCGACTCT
AAGTGCAGTCTCTGCTCAGCCTCCTCTCATGGGAAATGTT
GATCCCTCTAAAGTGGATGAGATCAGAAGGACGGTGTATG
TTGGCAATTTGAATTCACAGAGCACTACGGCAGATCAGCT
CCTCAAGTTCTTTAAGCAGGTGGGAGATGTGAAGTTTGTC
CGAATGGCAGGAGATGAAACCCAACCTACACGTTTTGCTT
TTGTGGAGTTTGCTGATCAGGATTCAGTGGCACGAGCACT
CACTTATAATGGAGTAATGTTTGGTGACAGACCACTGAAG
ATTAACCACTCCAATAATGCCATAGTGAAGCCTCCAGAGC
TTACACCCCAAGCTGCAGCCAAAGAGCTAGAGGACGTCAT
GAAGAAAGTCAGAGAGGCTCAGTCAACCATTGCTGCTGCT
ATCGAGCCAGAAAATGAACTCCCTTCATCCAGTAGATCCA
GGCATTCCAGAAGGTCCAGATCTCACTCTTGTTCTCCATC
TAACTCAAGAAGAAAGCGATCCAGGTCTAGACACAGAGGG
CATCCATCAAAGAGATCACGGCAGAGATTTAATGACTCAT
GTGGGTCCCATAGGAGACATTCTCGTTCCAGAGAAAGGAG
ACGCAGCCAGAGTCGATCTCATTCCAGGGGCCGAAGGAAG
GACAAAGACAGTAAAGGAAGGAAGGACGATGACTGGGATG
AAAAGAGGCTGCGGGACAAAACAGGAAGATCGCCTCCAAA
ATGCTATGTTGGTTCCAGACGGTCCCGCAGTACAAGCAGA
GGACATAAGAAAAGAAGCAGATCTCCATCCAGGTCACCAA
GGCAGAGAGCCAGGTCACCAACACCAACAAAAAGAGGCAA
GAGAGAAAAAAAGAGGGAGAAAGGATGGGACAGTAGCAGG
GAAAGAGCTGAGAGCTCAGCATTCAGAAGAAAAAGCAGGG
ATTCTGAATATAAAGCAAAACCCTCCCAGAGAGAAAGGGT
CTATGAACAGATGGAACACGAGTATGACAGTGAAATGGAC
GGCTCGGGCTCAATGGTTAGCGATGACAGATCTCCTCCAG
CTCATCTCAATGGCAGCTACAGGAGTTCTTACGCCGAGGA
GGACAATCTCTTTGCAGCTGAGTGATCACCGTCTACCAGT
AATGCCAAGAACTGTGTATCATACTGTAACAACTGACACT
CCTTTTAAAGTGCTTCTTCTGTGTTCGTTGTGTGATTGTA
GGTTTCTTAAAACGTTTTCTGCTGCTGTGAATATGCTCCT
GTCATATGATATTCATATGGATGAAAATGTAAAGATCTTT
TTTTGTCAGAAAGAAGTGGTTTATTGAACAACTTTTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations