ZFIN ID: ZDB-TSCRIPT-090929-6269
Transcript Name: srek1-201
Previous Names: srek1-001, zgc:100974-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000023049 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000023049|OTTDARG00000018877|ZDB-GENE-040801-132 srek1|OTTDARP00000019205 CH211-10H13.1-001 LG_ BX950207.16 Danio rerio protein_coding KNOWN, 1879 bp
ATTCCATGCTGTTTGCAGCTCTCCTTGCTATCGAGTATTT
TCTGCAGGTCAGTGCCGAATGTTGGCCATTTGATGCATTA
TTGCATTTTACAGTATTGAACCTCAGTTTAGTGTGAAATG
AGCGGTATGCCCGGAACCAACGTGATCCAAATAACTAATT
TGTCGGCGGCGGTAAGCAGCGATCAGATGAGAACTCTATT
CGGCTTCCTTGGGGACATCGATGAGCTGCGACTCTACCCG
CCTGACAATGCACCCCTTTCCTTCTCATCAAAAGTTTGTT
ACATAAAGTATCGGGAGCCTTCGAGTGTTGGTGTGGCACA
ACATTTAACCAACACTGTTTTTATTGACAGAGCTTTGATT
GTTGTGCCCTGCGCTGAAGGAAAAATCCCAGAAGAGGCAA
AGGCACTCTCGCTTTTGGCTCCTGCAACACCTGTGGCCAG
CCTGATGAGTGGAGGAGGACTTCTGCCAATTCCTAGCCCT
TCTACACTACAGAATCGGAGCCTCCCTTTAGCTAACCTGG
GGGTCCTGAAGTCTAGTTTGGACACTTCTGTGGCGACTCT
AAGTGCAGTCTCTGCTCAGCCTCCTCTCATGGGAAATGTT
GATCCCTCTAAAGTGGATGAGATCAGAAGGACGGTGTATG
TTGGCAATTTGAATTCACAGAGCACTACGGCAGATCAGCT
CCTCAAGTTCTTTAAGCAGGTGGGAGATGTGAAGTTTGTC
CGAATGGCAGGAGATGAAACCCAACCTACACGTTTTGCTT
TTGTGGAGTTTGCTGATCAGGATTCAGTGGCACGAGCACT
CACTTATAATGGAGTAATGTTTGGTGACAGACCACTGAAG
ATTAACCACTCCAATAATGCCATAGTGAAGCCTCCAGAGC
TTACACCCCAAGCTGCAGCCAAAGAGCTAGAGGACGTCAT
GAAGAAAGTCAGAGAGGCTCAGTCAACCATTGCTGCTGCT
ATCGAGCCAGAAAATGAACTCCCTTCATCCAGTAGATCCA
GGCATTCCAGAAGGTCCAGATCTCACTCTTGTTCTCCATC
TAACTCAAGAAGAAAGCGATCCAGGTCTAGACACAGAGGG
CATCCATCAAAGAGATCACGGCAGAGATTTAATGACTCAT
GTGGGTCCCATAGGAGACATTCTCGTTCCAGAGAAAGGAG
ACGCAGCCAGAGTCGATCTCATTCCAGGGGCCGAAGGAAG
GACAAAGACAGTAAAGGAAGGAAGGACGATGACTGGGATG
AAAAGAGGCTGCGGGACAAAACAGGAAGATCGCCTCCAAA
ATGCTATGTTGGTTCCAGACGGTCCCGCAGTACAAGCAGA
GGACATAAGAAAAGAAGCAGATCTCCATCCAGGTCACCAA
GGCAGAGAGCCAGGTCACCAACACCAACAAAAAGAGGCAA
GAGAGAAAAAAAGAGGGAGAAAGGATGGGACAGTAGCAGG
GAAAGAGCTGAGAGCTCAGCATTCAGAAGAAAAAGCAGGG
ATTCTGAATATAAAGCAAAACCCTCCCAGAGAGAAAGGGT
CTATGAACAGATGGAACACGAGTATGACAGTGAAATGGAC
GGCTCGGGCTCAATGGTTAGCGATGACAGATCTCCTCCAG
CTCATCTCAATGGCAGCTACAGGAGTTCTTACGCCGAGGA
GGACAATCTCTTTGCAGCTGAGTGATCACCGTCTACCAGT
AATGCCAAGAACTGTGTATCATACTGTAACAACTGACACT
CCTTTTAAAGTGCTTCTTCTGTGTTCGTTGTGTGATTGTA
GGTTTCTTAAAACGTTTTCTGCTGCTGTGAATATGCTCCT
GTCATATGATATTCATATGGATGAAAATGTAAAGATCTTT
TTTTGTCAGAAAGAAGTGGTTTATTGAACAACTTTTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
srek1-201 Contained in:
[BAC] CH211-10H13 (1)

Genome Resources: Vega_Trans:OTTDART00000023049 (1),  Ensembl_Trans:ENSDART00000134937 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC078219 (1) 1990 nt
GenBank:DT880817 (1) 773 nt
GenBank:DN898249 (1) 618 nt
GenBank:CK685445 (1) 594 nt
GenBank:BM861256 (1) 541 nt
GenBank:CD586570 (1) 338 nt
GenBank:CD586838 (1) 337 nt
CITATIONS (2)