Transcript

btf3-201

ID
ZDB-TSCRIPT-090929-6248
Name
btf3-201
Previous Names
  • btf3-001
  • btf3-002
  • ottdart00000023026
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000023026 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000023026|OTTDARG00000017981|ZDB-GENE-030131-8731 btf3|OTTDARP00000019193 btf3-001 LG_ BX530075.7 Danio rerio protein_coding KNOWN, 894 bp
GTCGTCACTTCCGTCCCCCTCTCTCGCTTCCATCTTGCTC
TCCGCGTGTGTTTGCTGCTAGCGTGCAGATGAAAGAAACG
ATAATGAACCAGGAGAAATTAGCCAAGTTGCAGGCACAAG
TCCGCATTGGTGGAAAGGGCACCGCTCGCAGAAAGAAGAA
GGTGGTCCACAGAACAGCCACTGCTGATGACAAAAAACTT
CAGTTCTCCCTCAAGAAATTGGGAGTAAATAACATCTCTG
GCATTGAGGAGGTGAACATGTTCACAAACCAAGGCACGGT
GATACACTTTAACAACCCCAAAGTGCAGGCCTCGCTGGCA
GCCAACACCTTCACCATCACAGGCCACGCCGAGACCAAGC
AGCTGACCGAGATGCTACCCTCAATCCTTAACCAGTTGGG
TGCTGACAGCCTGACCAGTCTGCGCAGACTTGCAGAGGCC
CTGCCCAAACAAGCTGGTGATGGAAAGGCACCGGTAGCTG
GTGGAGAGGAAGATGATGACGAAGTTCCAGATCTGGTGGA
GAATTTTGACGAGGCTTCAAAGAATGAGGCAAATTAACAT
CATGGGAAGGAAAAGGCGTTTGAGAATCTCTGGTCTCAGC
GGAGACTTGTGGGACTGTTTTTTTTTTTTTTTTGGTTTGT
TTTTCATTTCTTTTATAAATATATTGCATCCCTGAATCTC
CTATACTTTTTCGTGCACTGCTGTGGTCCTCGTGTCCAAG
CTGAGAGTGTGAGATTGATTGCACCACACAGGTTTATACA
CAGTTTAATGTGTGTGTTTGCTTGTGCGGTCCAAGAGGCA
TCTTTGCCTCCACCTTCCCTGTTACTGAGGCTCATTTGTT
TGGAGCCTGTCTGAATCAACATCTGGAAATAAACATTTGC
TATTGACAAAAACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations