Transcript

btf3-202

ID
ZDB-TSCRIPT-090929-5313
Name
btf3-202
Previous Names
  • btf3-001
  • btf3-003
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000021726 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000021726|OTTDARG00000017981|ZDB-GENE-030131-8731 btf3|OTTDARP00000018274 btf3-003 LG_ BX530075.7 Danio rerio protein_coding KNOWN, 954 bp
GTCACTTCCGTCCCCCTCTCTCGCTTCCATCTTGCTCTCC
GCGTGTGTTTGCTGCTAGCGTGCAGGTCAGTGAGGAGCTC
TAAAATACTATATTTCCTGCACAACCACTCCTGGTTCCGA
GGCTCAAGATGAAAGAAACGATAATGAACCAGGAGAAATT
AGCCAAGTTGCAGGCACAAGTCCGCATTGGTGGAAAGGGC
ACCGCTCGCAGAAAGAAGAAGGTGGTCCACAGAACAGCCA
CTGCTGATGACAAAAAACTTCAGTTCTCCCTCAAGAAATT
GGGAGTAAATAACATCTCTGGCATTGAGGAGGTGAACATG
TTCACAAACCAAGGCACGGTGATACACTTTAACAACCCCA
AAGTGCAGGCCTCGCTGGCAGCCAACACCTTCACCATCAC
AGGCCACGCCGAGACCAAGCAGCTGACCGAGATGCTACCC
TCAATCCTTAACCAGTTGGGTGCTGACAGCCTGACCAGTC
TGCGCAGACTTGCAGAGGCCCTGCCCAAACAAGCTGGTGA
TGGAAAGGCACCGGTAGCTGGTGGAGAGGAAGATGATGAC
GAAGTTCCAGATCTGGTGGAGAATTTTGACGAGGCTTCAA
AGAATGAGGCAAATTAACATCATGGGAAGGAAAAGGCGTT
TGAGAATCTCTGGTCTCAGCGGAGACTTGTGGGACTGTTT
TTTTTTTTTTTTTGGTTTGTTTTTCATTTCTTTTATAAAT
ATATTGCATCCCTGAATCTCCTATACTTTTTCGTGCACTG
CTGTGGTCCTCGTGTCCAAGCTGAGAGTGTGAGATTGATT
GCACCACACAGGTTTATACACAGTTTAATGTGTGTGTTTG
CTTGTGCGGTCCAAGAGGCATCTTTGCCTCCACCTTCCCT
GTTACTGAGGCTCATTTGTTTGGAGCCTGTCTGAATCAAC
ATCTGGAAATAAACATTTGCTATTGACAAAAACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations